ID: 1059432459

View in Genome Browser
Species Human (GRCh38)
Location 9:114258388-114258410
Sequence CCTTCCATGTGGAGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059432451_1059432459 -2 Left 1059432451 9:114258367-114258389 CCAGTGAGCCAGGTGCCCAGTCC 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1059432459 9:114258388-114258410 CCTTCCATGTGGAGGCTGCTGGG 0: 1
1: 0
2: 0
3: 29
4: 247
1059432452_1059432459 -10 Left 1059432452 9:114258375-114258397 CCAGGTGCCCAGTCCTTCCATGT 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1059432459 9:114258388-114258410 CCTTCCATGTGGAGGCTGCTGGG 0: 1
1: 0
2: 0
3: 29
4: 247
1059432450_1059432459 -1 Left 1059432450 9:114258366-114258388 CCCAGTGAGCCAGGTGCCCAGTC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1059432459 9:114258388-114258410 CCTTCCATGTGGAGGCTGCTGGG 0: 1
1: 0
2: 0
3: 29
4: 247
1059432449_1059432459 0 Left 1059432449 9:114258365-114258387 CCCCAGTGAGCCAGGTGCCCAGT 0: 1
1: 0
2: 1
3: 9
4: 220
Right 1059432459 9:114258388-114258410 CCTTCCATGTGGAGGCTGCTGGG 0: 1
1: 0
2: 0
3: 29
4: 247
1059432447_1059432459 11 Left 1059432447 9:114258354-114258376 CCTGCTGCTTTCCCCAGTGAGCC 0: 1
1: 0
2: 4
3: 35
4: 248
Right 1059432459 9:114258388-114258410 CCTTCCATGTGGAGGCTGCTGGG 0: 1
1: 0
2: 0
3: 29
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059432459 Original CRISPR CCTTCCATGTGGAGGCTGCT GGG Intronic
901033753 1:6323847-6323869 CCACCCCTGTGGAGGTTGCTAGG + Intronic
901263610 1:7892305-7892327 CCTTCCCTTTGGAGGCTCCAGGG + Intergenic
901684420 1:10935637-10935659 CCCTCCAGGTGGTGGCAGCTTGG + Intergenic
902206177 1:14869866-14869888 TGTTCCATGTGGTGGCTGCTGGG + Intronic
902371854 1:16012603-16012625 CTTTCCCTGTGGGGGCTGCCAGG + Intergenic
902581197 1:17408694-17408716 TCTTCCATGTGGCATCTGCTTGG + Exonic
903325884 1:22568295-22568317 CCTACCATGTTGAGCCTGCAGGG + Intronic
903339268 1:22643878-22643900 CCATCCATGGTGAGGCTCCTGGG + Intronic
903468665 1:23569299-23569321 CCTTCCATGTGAAGACAGCGTGG + Intergenic
903749431 1:25611641-25611663 CCTTCACTGAGGAGGCAGCTGGG - Intergenic
904457127 1:30654506-30654528 CCTTCCATGTGGTGGTGGGTGGG - Intergenic
906553963 1:46692271-46692293 TCATCCATGTTGAGGCTACTTGG + Intronic
908676859 1:66614740-66614762 CCTACCATGTGGAGGCAGAGAGG - Intronic
908959028 1:69671854-69671876 CATGCCATGTGGCCGCTGCTGGG + Intronic
917675144 1:177311744-177311766 CCTTCCTTTTTGAGGCTGCCTGG - Intergenic
920265084 1:204715642-204715664 CCTTCTGAGTGGAGGCTGTTAGG + Intergenic
922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG + Intergenic
922818348 1:228467285-228467307 CCCACCATATGGTGGCTGCTTGG + Intergenic
924299559 1:242623732-242623754 CCTACAATGTGCAGGATGCTGGG + Intergenic
1063224345 10:4001429-4001451 CCTTTAATGTGAAGGCTGCAGGG - Intergenic
1064029877 10:11877102-11877124 TGTTCCATGTGTAAGCTGCTGGG - Intergenic
1064655563 10:17552061-17552083 CCCTCCATGTGCAGTCTCCTGGG - Intergenic
1068105948 10:52616537-52616559 CCTTCCTTTTGGAGGCTGTAAGG + Intergenic
1069898138 10:71691611-71691633 CCTTCCATGTTGTGGCTCCAAGG + Intronic
1073488069 10:103834234-103834256 CCTTCCATGTGGTGGCCGAGGGG - Intronic
1073997756 10:109335374-109335396 ACTTCCATGTGGAGACTTCCTGG - Intergenic
1075171668 10:120121249-120121271 CCTGCCATGAGGAGTGTGCTGGG - Intergenic
1075412725 10:122240836-122240858 CCTTCCATTTGGGGACAGCTGGG + Intronic
1077167367 11:1149871-1149893 CCTTCCTTTTGGGGGCTGCTTGG + Intergenic
1078534187 11:12160206-12160228 CCTGCCAGGAGGAGCCTGCTGGG - Intronic
1079103135 11:17553650-17553672 CCTTCCAGGTGCAGACTGCCTGG - Intronic
1079357254 11:19740018-19740040 CCCTCCAGGGGGAGCCTGCTCGG - Intronic
1081630907 11:44688918-44688940 GCTCCCAGGTGGAGGCTGCCAGG + Intergenic
1082769424 11:57195333-57195355 CCTTCCATGTTGAGGGGGTTGGG - Intergenic
1083466679 11:62851581-62851603 CAATCCAGGTGGAGGCTGCAGGG + Intergenic
1083652158 11:64210016-64210038 CCTCCCATGTGGTAGCTGCAGGG - Intronic
1085457724 11:76674643-76674665 CCTTTCGTGTGGTGGCTGCGGGG - Intergenic
1085643812 11:78209815-78209837 CCTTCGATGTACAGGCTGGTGGG - Exonic
1087814104 11:102639276-102639298 CCTTCAATTTGGAGTCAGCTGGG + Intergenic
1088173287 11:107019773-107019795 CCTTCCAGGTGAAGGCAGATGGG + Intergenic
1089213823 11:116823536-116823558 CCTTCCATGCTGAGGTTGGTGGG - Intergenic
1090313459 11:125764033-125764055 CCTTCCCACTGCAGGCTGCTGGG + Intergenic
1095978006 12:47952813-47952835 GCTGCCAGGTGGAGGCTGTTAGG - Intergenic
1096743648 12:53712057-53712079 CCTTCCATGTGGGGGTGGCAGGG + Exonic
1097457872 12:59822181-59822203 TCTTCCACGTGGATGCTGTTTGG + Intergenic
1097694385 12:62762571-62762593 GTTGCCATGTGGAGGGTGCTAGG + Intronic
1097768046 12:63548054-63548076 CCTTCCATGTGGTATCAGCTGGG - Intergenic
1097784407 12:63743120-63743142 CCTTCCATGTGGTATCAGCTGGG - Intergenic
1098217588 12:68236497-68236519 GCTGACATGTGAAGGCTGCTAGG - Intergenic
1098558839 12:71850350-71850372 CCTGCCATGTGGAGCCGGCGGGG + Intronic
1101827881 12:108234625-108234647 GCTTCCTTGTGGGAGCTGCTGGG + Intronic
1102593305 12:113973693-113973715 GCTTCCCTCTGGAGGCTGCAGGG + Intergenic
1103323123 12:120103036-120103058 GCTTCCATGTGGAGGGTGCCAGG - Intronic
1103943001 12:124511018-124511040 CCTGCCATGTGCAGTGTGCTGGG - Intronic
1111281617 13:86032645-86032667 CATTCCATCTGGAGGCAGTTGGG + Intergenic
1111477254 13:88767048-88767070 CCTTCCCTCTGGAGGCTCTTGGG + Intergenic
1111484872 13:88883616-88883638 CCTTCCATGTTGATGTTGATGGG + Intergenic
1112637146 13:101227536-101227558 ATTTCCATGTGGAGGTTGCTGGG + Intronic
1113691876 13:112316822-112316844 CCTTCAAGATGGAGGCTGGTAGG + Intergenic
1115372856 14:32638131-32638153 CCTTAGATGTAGAGGCTGCTCGG - Intronic
1116861878 14:50001789-50001811 CCTTCCACGGAGAGGCTGCCGGG + Intronic
1117022003 14:51580304-51580326 ACTTCCAGGTTGAGCCTGCTGGG - Intronic
1117501652 14:56358367-56358389 CCTTCTCTCTGGAGGCAGCTGGG - Intergenic
1118892426 14:69921343-69921365 CCTTCCCAGGGGAGGCTGTTAGG + Intronic
1119508048 14:75189891-75189913 TTTTCCATCTGGAGGCTGATTGG - Intergenic
1119674997 14:76546964-76546986 GCATCCCTGTGGAGGCTCCTGGG - Intergenic
1122157457 14:99758714-99758736 CATTCCATACGGAGGCTTCTGGG + Intronic
1122804592 14:104250134-104250156 CTTTCCTCGTGGAGGTTGCTGGG + Intergenic
1123032469 14:105458429-105458451 CCTTCCCTGTGGTGGGTGTTGGG + Intronic
1123187293 14:106531813-106531835 TCTTTCATGTGGACGCTGTTAGG + Intergenic
1202862075 14_GL000225v1_random:89486-89508 CCTGCCATGTGGAGGCCTCCAGG + Intergenic
1123690220 15:22832564-22832586 ACTTCCCTCTGGAGGCTCCTGGG + Intergenic
1124239757 15:28019646-28019668 CCTGCCCTGTGGAGGAGGCTGGG - Intronic
1124626098 15:31308361-31308383 CCTTTCTTGTTGAGGCTGCTGGG - Intergenic
1127600536 15:60531765-60531787 CATTACATGTGAAGGCTGCAAGG - Exonic
1127632168 15:60837571-60837593 CCTTCCATGGGGAGCCTGTTTGG + Intronic
1128803625 15:70514206-70514228 CCCTCCATATGGAGCCTGCTGGG - Intergenic
1129461818 15:75703532-75703554 CCTTCCCCGTGGAGACTGCCGGG - Intronic
1129723035 15:77888314-77888336 CCTTCCCCGTGGAGACTGCCGGG + Intergenic
1129879721 15:78998685-78998707 CCCTCCCTGGGCAGGCTGCTGGG - Intronic
1130061193 15:80571383-80571405 CATTCCAAGTGTAGGCTGTTTGG - Intronic
1132765190 16:1530939-1530961 CCTGCCAGGCCGAGGCTGCTGGG + Intronic
1132937445 16:2488288-2488310 CCCTCCCTGGGAAGGCTGCTGGG + Intronic
1132954046 16:2581543-2581565 CCCTGCGTGTGGAGGCTTCTGGG + Intronic
1132960299 16:2618620-2618642 CCCTGCGTGTGGAGGCTTCTGGG - Intergenic
1133429700 16:5725851-5725873 ACTGGCATGAGGAGGCTGCTGGG + Intergenic
1134169292 16:11955821-11955843 CCTTCCACTGGGAGGATGCTTGG + Intronic
1134485111 16:14651766-14651788 TCTTCCATGAGGAGGGTGCGGGG - Intronic
1134607877 16:15585319-15585341 CCTTGCATGTGGTGCATGCTTGG - Intronic
1136366203 16:29810333-29810355 CTTTCCTTCTGGAGGCTCCTTGG - Exonic
1139163913 16:64543571-64543593 CGTTTCATATGTAGGCTGCTAGG - Intergenic
1139853367 16:69963435-69963457 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139882336 16:70186344-70186366 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1140370173 16:74409160-74409182 CCTTCCTAGCAGAGGCTGCTGGG + Intronic
1141005702 16:80349662-80349684 CCTTACATGTGGGGGATGATGGG - Intergenic
1141595125 16:85092723-85092745 CCTTTCCTGTGGACGCAGCTGGG - Exonic
1141728138 16:85804055-85804077 CCTTGCCTGTAGAGGGTGCTTGG + Intronic
1142346438 16:89557047-89557069 GCCTCCAAGTGGAGGCTGCTGGG - Exonic
1142602075 17:1058470-1058492 CCTTGCAGGAGGAGGCAGCTGGG + Intronic
1142691191 17:1606893-1606915 CCTCCCAAGTGGAGGCTCCGAGG - Intronic
1147122468 17:38343740-38343762 CCTCCTATGTGGGGGCTGCTGGG - Exonic
1147266548 17:39237897-39237919 CCTTACCTGAGCAGGCTGCTGGG - Intergenic
1149413430 17:56432715-56432737 CCTCCCAGGTGGTGACTGCTTGG + Intronic
1149638484 17:58188192-58188214 TCTTCCATGTGGAAGTTGGTTGG + Intergenic
1151647628 17:75444170-75444192 CCTGCCAAGGGGAGGCGGCTGGG + Intronic
1151956859 17:77384465-77384487 GCCTCCATTCGGAGGCTGCTAGG - Intronic
1151956992 17:77385346-77385368 GCCTCCATTCGGAGGCTGCTGGG + Intronic
1152887378 17:82860376-82860398 TTTTCCCTGTGGTGGCTGCTCGG + Intronic
1154266946 18:12886722-12886744 CCTGCCATGTGAAGGCCCCTAGG + Intronic
1154297248 18:13161929-13161951 ACTGCCATGGGGAGGCTGCTTGG - Intergenic
1155026607 18:21946312-21946334 CCTTCCTTCTGGAGGCTGCAGGG + Intergenic
1156381137 18:36562548-36562570 CCAGCCATTTGGAGCCTGCTGGG + Intronic
1156395066 18:36691819-36691841 CCTTGCATTTGCAGGCTGATGGG - Intronic
1157862673 18:51154843-51154865 TCTGCCATGTGGGGGCTGCGTGG - Intergenic
1158878048 18:61751870-61751892 TCCTCCAGGTGGAAGCTGCTTGG - Intergenic
1159092148 18:63861332-63861354 CCTGCCATGTGGCCCCTGCTGGG + Intergenic
1160717852 19:584502-584524 CCTGCTAGGTGGGGGCTGCTGGG + Intergenic
1161562552 19:4981552-4981574 ACGTCCAGGTGGAGGCTGCTGGG - Intronic
1161567927 19:5013675-5013697 CCTCCCATGAGGAGGCTGTGAGG + Intronic
1162731460 19:12721353-12721375 CCCTGGATGTGGAGGCGGCTGGG - Intronic
1165909340 19:39215187-39215209 CCTTCCTTCTGGAGGCTCCAGGG + Intergenic
1168108819 19:54180720-54180742 CCTTGGAGGTGGGGGCTGCTGGG + Intronic
925227742 2:2200354-2200376 CCTTCCTTGTGGAGGCTCCAAGG + Intronic
926196836 2:10769108-10769130 CCTCCCCTGTGGAGGCTGCACGG + Intronic
927265538 2:21145112-21145134 CCTTCCATGTGGAGGTTCATGGG - Intergenic
928374816 2:30765584-30765606 CCTTTCATCTGGAAGCTGCAGGG + Intronic
929570791 2:43021818-43021840 CCTTCACCGCGGAGGCTGCTGGG + Intergenic
929948282 2:46387105-46387127 ACTTCAATTTGGAGGCGGCTGGG + Intergenic
931095766 2:58939004-58939026 CCTTTCTTCTGGAGGCTGTTGGG - Intergenic
931343509 2:61425612-61425634 CCCTCCATGGTGAGGCTGGTGGG - Intronic
931928366 2:67099906-67099928 CCTTCTTTGTGCAGGCTTCTGGG + Intergenic
932674163 2:73764056-73764078 CCTTCCATGTGTCAGATGCTGGG - Intronic
937084480 2:119161573-119161595 GCTGCTATGTGGAGGCTGCCTGG - Intergenic
937235831 2:120431533-120431555 CTGTCCCTGTGGAGGCTGCATGG + Intergenic
937574805 2:123407116-123407138 CTCTCCATGTGCAGGCTGATCGG - Intergenic
937643905 2:124244441-124244463 CCTACCATGTCAAGGCTGTTTGG - Intronic
937984144 2:127631035-127631057 CCACCCATGTGGAGCCTGCCTGG + Intronic
938087348 2:128410159-128410181 CCTGCAATGTGGAGGCTTCCTGG - Intergenic
940096934 2:149987443-149987465 CCTTCTCTGTGGAGGTAGCTGGG - Intergenic
940136291 2:150439793-150439815 TCTTCCATGTGGAGACAGATTGG - Intergenic
945296218 2:208174026-208174048 CCTGGGAGGTGGAGGCTGCTGGG - Intronic
947492022 2:230603390-230603412 CCTTCCATGTTGATCTTGCTGGG - Intergenic
1168765212 20:377575-377597 AGGTCCATGTGGAGGCTGCAGGG + Intronic
1169558233 20:6770543-6770565 CCGTCCCTGTAGAGGCAGCTTGG + Intronic
1172176933 20:32978073-32978095 CCTGCCACATGCAGGCTGCTGGG - Intergenic
1172240368 20:33408874-33408896 CATTCCACGTGCAGGCTGCAGGG + Exonic
1173655664 20:44698715-44698737 CCTTCCATGTCCAGGCTGGGAGG + Intergenic
1175417817 20:58813113-58813135 CCTTCGTTTTGGAGGCAGCTTGG + Intergenic
1175611752 20:60357582-60357604 CCTTCCAAGGAGAGGCTACTTGG + Intergenic
1175811089 20:61857552-61857574 CCCCCCATGTGGAGGGAGCTGGG + Intronic
1176933853 21:14843874-14843896 CCTTCCCTCTGAAGTCTGCTTGG + Intergenic
1178152114 21:29807267-29807289 CCTTCCCTGTGGCGGCTGTGGGG + Intronic
1178717522 21:34979890-34979912 TCTGCCAGGTGGAGGGTGCTGGG + Intronic
1179477033 21:41653615-41653637 CCTTCCCTGGGCAGCCTGCTGGG - Intergenic
1180062475 21:45392772-45392794 GCGTCCAGGTGGGGGCTGCTGGG + Intergenic
1180087986 21:45516588-45516610 GGCTCCATGTGCAGGCTGCTGGG - Intronic
1181058831 22:20272409-20272431 CCCACCACCTGGAGGCTGCTGGG + Intronic
1181615021 22:24048331-24048353 CCATCTATGTAGTGGCTGCTTGG + Intronic
1182459215 22:30472196-30472218 CCTGCCAGGAGGAGGCAGCTGGG + Intergenic
1183454092 22:37912145-37912167 CCATGCATGAGGAGGCTGGTGGG - Intronic
1183736366 22:39646958-39646980 CCTGGAATTTGGAGGCTGCTGGG - Intronic
1184361515 22:44021930-44021952 ATTTCCATTTGGAGGCTGCACGG - Intronic
1184784749 22:46666210-46666232 CCCTCCCTGTGGAGGCTGAGGGG + Intronic
949932814 3:9092600-9092622 CTTTCCCAGTGGAGGCAGCTTGG - Intronic
950132145 3:10554573-10554595 CATTCCTTCTGGAGGCTGCGGGG - Intronic
952121157 3:30245996-30246018 TGTTCTATGTGGAGGCTGCTCGG + Intergenic
953385039 3:42501660-42501682 GCTTCCAAGGGGCGGCTGCTCGG - Intronic
953680213 3:45033486-45033508 CCTCCCATGTGTATGCTGGTTGG - Intronic
953813233 3:46132280-46132302 ACCTCCAGGTGGAGGCTGGTGGG + Intergenic
954993262 3:54859411-54859433 CATTCTCTGTGGAGGTTGCTAGG + Intronic
955142984 3:56288071-56288093 CTTTACATGTGGAGGCGGCTTGG - Intronic
961378954 3:126484782-126484804 CCTCCCACCTGGAGGCTGGTGGG - Intronic
963406307 3:144868144-144868166 CCCTCCCTGTGGAGGGTGTTGGG + Intergenic
964395473 3:156241087-156241109 CCTGCCATGTGCAGGCAGCGTGG + Intronic
967020965 3:185522269-185522291 GTTGCCATGTGGAGGTTGCTGGG - Intronic
968359806 3:198138950-198138972 CCTTCCATGTTGGGGCTTCTCGG - Intergenic
968643249 4:1725622-1725644 TCTGCCCTATGGAGGCTGCTGGG - Intronic
968795153 4:2698417-2698439 CCATCCACGAGGTGGCTGCTGGG + Intronic
969062039 4:4444130-4444152 GCTGCCATGTGGAGGTTGTTTGG + Intronic
969121350 4:4913717-4913739 CCTAGCATGGGGAAGCTGCTGGG + Intergenic
969240970 4:5897273-5897295 CCTTCCTTCTGGAGGCTCCAGGG - Intergenic
969604434 4:8195454-8195476 CCTTCCTCTAGGAGGCTGCTGGG + Intronic
969882930 4:10190332-10190354 CCCTCCCTGTGGTTGCTGCTGGG - Intergenic
970980966 4:22096447-22096469 CCTGCAATGTGGATGCAGCTGGG - Intergenic
972451659 4:39206322-39206344 ACTGCCATGGGGAGACTGCTTGG - Intronic
974595730 4:64012671-64012693 CCTCCCATGTGGCGGGTGCCAGG + Intergenic
976555759 4:86449633-86449655 CCTTCAATGTGGAGGAAACTAGG + Intronic
977470449 4:97436468-97436490 CCTTCCATTTTTAGGCTTCTGGG + Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
980992720 4:139751930-139751952 CCTTTTATATGGAGGCTCCTTGG - Intronic
983719342 4:170828046-170828068 CATTCCATGTTGAGTCAGCTTGG + Intergenic
985017579 4:185652440-185652462 TCCTCCATGGGGAGGCTTCTTGG + Intronic
985090479 4:186357899-186357921 CCTTCCTTCTGGAGGCTCCTGGG - Intergenic
985547864 5:519102-519124 CCTCCCCTGTGGAGACTCCTGGG + Intronic
986571443 5:9170179-9170201 CCTTCCATGTCCAGCCTGGTAGG + Intronic
988202736 5:28088596-28088618 CTGTCCATGTGGAGTCTGCAAGG - Intergenic
988965981 5:36418371-36418393 CCTTCCATGTGGAGCCAAGTGGG - Intergenic
990191699 5:53267127-53267149 CCATGCATGTGGATGATGCTAGG + Intergenic
990238375 5:53792223-53792245 CATTCCAAGTACAGGCTGCTGGG + Intergenic
991185428 5:63801074-63801096 CCTTACATCTGGAGGGGGCTGGG - Intergenic
992473834 5:77083218-77083240 CCTTAACTGTGGAGGCTGGTGGG + Intronic
993945406 5:94111828-94111850 CCTTCCTTGTGAAGGCTGCCTGG + Intergenic
994099555 5:95878460-95878482 CCTCCCTTGTGGAGGTTTCTGGG - Intergenic
997614589 5:135237652-135237674 CCTGCCCTGTGGAGCCAGCTGGG + Intronic
997821547 5:137070570-137070592 CCTTCCTTGTGCAGGCAGATTGG - Intronic
998561091 5:143172406-143172428 CCTTCTTTGTCGTGGCTGCTAGG - Intronic
998943647 5:147313157-147313179 CCTTGGAAGTGGAGGCTGCGGGG + Intronic
999181841 5:149675371-149675393 CCTTCCTTGGAGAGGCTGATAGG - Intergenic
999447327 5:151650496-151650518 CCTTCCTTCTGGTGGCTGCATGG - Intergenic
999889076 5:155957250-155957272 CCTTCAGTGCTGAGGCTGCTGGG + Intronic
1001173437 5:169443356-169443378 CCTGGCATGTGGAAGCAGCTTGG - Intergenic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1002948526 6:1785690-1785712 CCTTCCCTGCCGAGGATGCTGGG - Intronic
1004044656 6:12012324-12012346 CCTTCAGCGTGGCGGCTGCTGGG + Exonic
1004335673 6:14762390-14762412 CCTTCCAGGTTCGGGCTGCTTGG + Intergenic
1006880181 6:37332311-37332333 CCCTTCCTGGGGAGGCTGCTAGG - Exonic
1014405939 6:121050955-121050977 CCTTCCATCTGGAAACTCCTGGG + Intergenic
1016357136 6:143230164-143230186 CCTTCCATTGGGAAACTGCTAGG - Intronic
1017243565 6:152197111-152197133 CGTGCCATGTGGCTGCTGCTGGG + Intronic
1017912739 6:158808238-158808260 GCTGCCAGGTGGAGGCTGTTAGG + Intronic
1019156852 6:170044990-170045012 CCTCCCATGTGCAGGCTCCCTGG - Intergenic
1019260181 7:77698-77720 CCTTCCATGTTGGGGCTTCTCGG + Intergenic
1019565152 7:1675377-1675399 CCTGACATTTGGAGGCTGTTGGG + Intergenic
1019613753 7:1949550-1949572 CCTGCCAAGTGGAGGCGGCGGGG + Intronic
1023847360 7:44129940-44129962 CCTTCTGAGTGGAGGGTGCTGGG - Intergenic
1025146942 7:56513493-56513515 GCTTGCATCTGGAGGCTGCAGGG - Intergenic
1026319331 7:69255307-69255329 GCTTGCATCTGGAGGCTGCAGGG + Intergenic
1026405830 7:70064576-70064598 CCCTCCAAGTGGGAGCTGCTTGG + Intronic
1026513202 7:71044527-71044549 CCTGCAAAGTGGTGGCTGCTGGG + Intergenic
1027231688 7:76276430-76276452 CCTTCCATATGGACTCTGCCAGG - Intronic
1028094315 7:86741359-86741381 GTTGCCATGTGGAGGTTGCTGGG - Intronic
1029259688 7:99293432-99293454 CCTTTGCTATGGAGGCTGCTGGG + Intergenic
1032238758 7:130145222-130145244 CCTGCCATGTGGCAGCTGATTGG - Intergenic
1033820576 7:145129881-145129903 CCTGGCATGAAGAGGCTGCTGGG + Intergenic
1035049307 7:155989517-155989539 CCTTCCCTGGGAAGGCTGCAGGG + Intergenic
1037680160 8:21090406-21090428 CCTACCATGTGTTGTCTGCTAGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1042055126 8:64756209-64756231 TCTTCAATGTGGAGGCAGTTTGG + Intronic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1044355256 8:91214889-91214911 GTTTCCATCTGGAGGCTCCTGGG + Intronic
1046615386 8:116471924-116471946 CCTTCCTTGTGAAGACTGATTGG - Intergenic
1046677615 8:117128314-117128336 CCTTTCCTGTGGCAGCTGCTAGG - Intronic
1046750178 8:117918748-117918770 CATTCCATGTGGCATCTGCTGGG - Intronic
1047407166 8:124595397-124595419 CATTCCTTCTGGAGGCTGCAGGG + Intronic
1047543548 8:125793810-125793832 CCTTTCATTTGGAAGGTGCTTGG + Intergenic
1047697791 8:127420121-127420143 TCTACCTTATGGAGGCTGCTTGG - Intergenic
1049107886 8:140624987-140625009 CCTTCCTGGAGGAGGCTGCTGGG - Intronic
1049210656 8:141385041-141385063 CCCTCCATGGGGAGCCTGGTGGG - Intergenic
1049248949 8:141577976-141577998 CCTACAATGCGTAGGCTGCTGGG - Intergenic
1049260998 8:141639234-141639256 CCTCCCGGGTGGAGGCTGCAAGG - Intergenic
1049288686 8:141790488-141790510 GCTGCCAGGAGGAGGCTGCTGGG + Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1051842465 9:21414031-21414053 CATGCCATGTGGCTGCTGCTAGG + Intronic
1053214733 9:36260987-36261009 CCTTCCTACTGGAGGCTGCCAGG + Intronic
1053480739 9:38414625-38414647 CCTTCCACGTGGAGGGTGTTAGG + Intronic
1056478289 9:86974570-86974592 CCTTCCAAGGGGATGATGCTTGG + Intergenic
1059060941 9:111035126-111035148 CCTTCCATGTGGTAGATGCAAGG - Intronic
1059323307 9:113485942-113485964 ATTTCCATGTGTAGGCTGGTCGG - Intronic
1059432459 9:114258388-114258410 CCTTCCATGTGGAGGCTGCTGGG + Intronic
1062040990 9:134404256-134404278 CCTTCCATGTGGCGGCGTCCAGG + Intronic
1062371635 9:136242295-136242317 CCTTCCAGCTGGAGGCTCCTGGG + Intronic
1062744511 9:138202771-138202793 CCTTCCATGTTGGGGCTTCTTGG - Intergenic
1186452986 X:9688601-9688623 CCTTCCATGTTGAGGGTTTTTGG + Intronic
1188725499 X:33577789-33577811 CCTGCCATGTGGCTGCTGTTGGG - Intergenic
1191858375 X:65645741-65645763 CCATCAAGGTGGAGGCAGCTGGG - Intronic
1192916603 X:75658028-75658050 CCTTCCAAATGGAGACTGCCAGG + Intergenic
1193152520 X:78139823-78139845 CCTTCCCCATGGAGCCTGCTGGG + Intergenic
1193601883 X:83516757-83516779 CCTGCCCTGAGGAGGCTGCTGGG - Intergenic
1195543443 X:106088293-106088315 CATTCCATGTGGCCTCTGCTGGG + Intergenic
1195656662 X:107337779-107337801 CATTCCATGATGAGGCTGATTGG + Intergenic
1196866440 X:120075465-120075487 ACTTCCATGTGGAGGCATCCTGG - Intronic
1196876658 X:120160816-120160838 ACTTCCATGTGGAGGCATCCTGG + Intronic
1198407172 X:136325189-136325211 CCTTCCAGGAGGAAGCTGTTAGG + Intronic
1200038784 X:153350652-153350674 CCTTCCAAGTTGTGTCTGCTAGG - Exonic
1200766354 Y:7083820-7083842 TCTTCCAGGAGCAGGCTGCTGGG - Intronic
1200875941 Y:8154966-8154988 CCTTCCTTGTGGAGGATGTTAGG - Intergenic