ID: 1059432627

View in Genome Browser
Species Human (GRCh38)
Location 9:114259201-114259223
Sequence CAGGGTCAAAAGAGGGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059432618_1059432627 15 Left 1059432618 9:114259163-114259185 CCTGAAGGTGATACAGGAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059432627 Original CRISPR CAGGGTCAAAAGAGGGACGA GGG Intronic
No off target data available for this crispr