ID: 1059433953

View in Genome Browser
Species Human (GRCh38)
Location 9:114265464-114265486
Sequence AGGGCTCTTACCGGTTCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059433953_1059433963 17 Left 1059433953 9:114265464-114265486 CCAGGAGAACCGGTAAGAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1059433963 9:114265504-114265526 TTCTTTGCCGCTGGCACCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 131
1059433953_1059433965 23 Left 1059433953 9:114265464-114265486 CCAGGAGAACCGGTAAGAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1059433965 9:114265510-114265532 GCCGCTGGCACCTGGGGGTGTGG 0: 1
1: 0
2: 5
3: 39
4: 409
1059433953_1059433960 8 Left 1059433953 9:114265464-114265486 CCAGGAGAACCGGTAAGAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1059433960 9:114265495-114265517 CTCTTCTGCTTCTTTGCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 188
1059433953_1059433961 15 Left 1059433953 9:114265464-114265486 CCAGGAGAACCGGTAAGAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1059433961 9:114265502-114265524 GCTTCTTTGCCGCTGGCACCTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1059433953_1059433967 24 Left 1059433953 9:114265464-114265486 CCAGGAGAACCGGTAAGAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1059433967 9:114265511-114265533 CCGCTGGCACCTGGGGGTGTGGG 0: 1
1: 1
2: 0
3: 19
4: 237
1059433953_1059433964 18 Left 1059433953 9:114265464-114265486 CCAGGAGAACCGGTAAGAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1059433964 9:114265505-114265527 TCTTTGCCGCTGGCACCTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1059433953_1059433968 29 Left 1059433953 9:114265464-114265486 CCAGGAGAACCGGTAAGAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1059433968 9:114265516-114265538 GGCACCTGGGGGTGTGGGCCAGG 0: 1
1: 0
2: 12
3: 76
4: 620
1059433953_1059433962 16 Left 1059433953 9:114265464-114265486 CCAGGAGAACCGGTAAGAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1059433962 9:114265503-114265525 CTTCTTTGCCGCTGGCACCTGGG 0: 1
1: 0
2: 0
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059433953 Original CRISPR AGGGCTCTTACCGGTTCTCC TGG (reversed) Exonic
900872385 1:5313216-5313238 AGGGCTGCTCCCTGTTCTCCAGG - Intergenic
907426586 1:54383448-54383470 ATGGCTCTTATCTGTTCTTCAGG - Intronic
911087780 1:93993541-93993563 AGGGCTCTTACAGGGTCTTTTGG + Intronic
912605045 1:110981497-110981519 AGGGGTCTGACCTGTTCTCTTGG - Intergenic
913165019 1:116177202-116177224 TGGGCTTTTACAAGTTCTCCAGG + Intergenic
917526812 1:175795498-175795520 AGGGCTCTAACCAGTTCCCCAGG - Intergenic
918314330 1:183310501-183310523 AGGGGTCTTCCTGGTTTTCCTGG - Intronic
1063814677 10:9758663-9758685 AGGGCTTTTACATTTTCTCCAGG + Intergenic
1070918840 10:80171489-80171511 AGGGCACATACCGGTCCTGCTGG - Intronic
1076808038 10:132869119-132869141 ACGGCTGTGGCCGGTTCTCCTGG - Intronic
1077574464 11:3371014-3371036 AGGGCTCTTTTCGTTGCTCCAGG + Exonic
1078108833 11:8375725-8375747 AGGGCTCTTACCCCTTCACTTGG + Intergenic
1079541260 11:21578310-21578332 ATGGCTCTTTCCCATTCTCCTGG - Intergenic
1083847398 11:65344035-65344057 AGGGCTTATCCCGGTCCTCCAGG - Exonic
1085647660 11:78237504-78237526 AAGGCTGTTACTGGTTCTCTAGG + Intronic
1087292535 11:96335750-96335772 TTTGCTCTTACCGGATCTCCAGG + Intronic
1089807568 11:121105144-121105166 AGGGCTCTGATTGGTCCTCCTGG - Intronic
1093644642 12:21571146-21571168 AGGCCTCTCACGGGGTCTCCAGG - Intronic
1100167265 12:91929900-91929922 AGGGCTGTTCTCTGTTCTCCTGG - Intergenic
1101880490 12:108622719-108622741 ATGGCTCTCCCCGCTTCTCCTGG - Intronic
1114539123 14:23441962-23441984 AGGGCTTTTGCTGGTGCTCCAGG + Intergenic
1119264127 14:73254138-73254160 AGGGCTCTTCCTTTTTCTCCAGG + Intronic
1121709867 14:96029962-96029984 ATGGATCTTACAGGTTTTCCAGG - Intergenic
1121927502 14:97941718-97941740 TGGGTTCTTATCGGTTCTTCTGG + Intronic
1128034331 15:64510394-64510416 TGGGATCTTACTGGTTGTCCAGG + Intronic
1141827150 16:86488594-86488616 AGGGCTCTTACCTACTCCCCTGG + Intergenic
1143424085 17:6819224-6819246 AGGGCTCTTTCAAGGTCTCCAGG + Exonic
1146962041 17:36989400-36989422 AGAGTTCTTACCGGTTCCCCTGG - Exonic
1147187528 17:38720674-38720696 AGGGCTCTTGCTGGTGCTCAAGG - Exonic
1150134834 17:62689892-62689914 AGGGCTCTCGGCGGTACTCCTGG + Exonic
1152467177 17:80473022-80473044 GGGGCTCCTACCACTTCTCCTGG + Intronic
1153793457 18:8600912-8600934 TGGGGTCTTACCTGTTATCCAGG + Intergenic
1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG + Intronic
1163721688 19:18900912-18900934 AGGGCTCTGGCTGGGTCTCCTGG - Intronic
926740263 2:16104759-16104781 AGAGCTCACACCAGTTCTCCGGG + Intergenic
926927320 2:18000902-18000924 AGGGCTCTTATTGGCTCTGCAGG - Intronic
930030666 2:47056415-47056437 AGGCCTCTTAGGGCTTCTCCAGG - Intronic
934213353 2:90005493-90005515 AGGTTTCTAACCGGTTCTCTGGG + Intergenic
942957408 2:181789281-181789303 AGAGCTCTTACAGGTTTTCCAGG - Intergenic
943279072 2:185908402-185908424 AGGCTTCTTTCTGGTTCTCCTGG + Intergenic
944489573 2:200244360-200244382 AGATCTCTTACTGCTTCTCCTGG - Intergenic
945627552 2:212229670-212229692 AGGGCTGTTACAGCTTATCCAGG + Intronic
1175129534 20:56779174-56779196 AGGCCTCTTACTGGTTTTCTCGG + Intergenic
1182133977 22:27883517-27883539 AGGGCTCTTTCTGGCCCTCCAGG - Intronic
1183261483 22:36798527-36798549 AGGGCTCTGACCTGGTTTCCGGG + Intergenic
952159263 3:30677366-30677388 TGGCCTCTTTCCGGTTCCCCAGG - Intronic
952335409 3:32399486-32399508 AGGCCTCTTAGAGGGTCTCCAGG - Intronic
954817424 3:53293897-53293919 GGGGCCCTTACCAGTTGTCCTGG - Intronic
974560902 4:63516314-63516336 TGGGCTTTTACCGGTTTTCAAGG + Intergenic
985074625 4:186201756-186201778 AGGGCTCTTAACTGTCCTCTAGG - Intronic
986286127 5:6360366-6360388 AGGAGTCTTCCCGATTCTCCAGG - Intergenic
990475716 5:56160012-56160034 AGGGCCCTTTCCGTTTCTCTGGG + Intronic
997548356 5:134730316-134730338 AGGGCTCTTAGTGGTGCTTCTGG + Intergenic
1006727495 6:36210499-36210521 AAGACTTTTACCGCTTCTCCTGG + Exonic
1012865077 6:104609218-104609240 AGGTCTCTTTCTGGTCCTCCAGG - Intergenic
1018993891 6:168695872-168695894 AGGGCTCTCAACGGATCCCCAGG + Intergenic
1019821831 7:3249599-3249621 CTGGCTTTTACCGGTTGTCCTGG - Intergenic
1022511071 7:30935276-30935298 TGGGCCCTTCCCAGTTCTCCAGG + Intergenic
1024924183 7:54595658-54595680 AGGGCTCTTCCCAGATCTACAGG + Intergenic
1032113431 7:129096516-129096538 AGGGCTCTTTCCTTTGCTCCAGG + Intergenic
1038542745 8:28402627-28402649 AGGGCTCTCACCTCTTCCCCAGG + Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1048748313 8:137641457-137641479 AGGGCTCTTCCCCCTTTTCCTGG + Intergenic
1048860394 8:138720432-138720454 GGGGCTCTTTCCGGCTCTCGTGG + Intronic
1051590524 9:18772804-18772826 AGGTCTCCTACAGGCTCTCCTGG + Intronic
1052963927 9:34324531-34324553 ACGTCTCATACCTGTTCTCCTGG + Intronic
1053053514 9:34980020-34980042 GGGGCTCTTACCTACTCTCCTGG + Exonic
1057240041 9:93400001-93400023 AGGGTCCTCACAGGTTCTCCTGG - Intergenic
1059433953 9:114265464-114265486 AGGGCTCTTACCGGTTCTCCTGG - Exonic
1059438094 9:114288500-114288522 AGGGGGCTTACCCGATCTCCAGG - Exonic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1062390395 9:136331465-136331487 TGGCCGCCTACCGGTTCTCCAGG - Intronic
1062442528 9:136577283-136577305 AGGGCCCTTCCAGGTACTCCAGG - Intergenic
1062678663 9:137763911-137763933 AGGGCTCTGCCCGCTCCTCCCGG - Intronic
1185613116 X:1403728-1403750 TGGGCCTTTTCCGGTTCTCCTGG + Intronic
1188953133 X:36401348-36401370 GGGGCTCTTACCACTTCTACGGG + Intergenic
1190753629 X:53382350-53382372 AGGGCTCTTCAGGGTTCTCAGGG + Exonic
1191183006 X:57582197-57582219 TGGGCTCTTACCTCTTCTCCAGG + Intergenic
1191214362 X:57920178-57920200 TGGGCTCTTACCTCTTCTCCAGG - Intergenic