ID: 1059437084

View in Genome Browser
Species Human (GRCh38)
Location 9:114283525-114283547
Sequence GTGGGGAACTCCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 459}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059437067_1059437084 11 Left 1059437067 9:114283491-114283513 CCCTGGAGCCAGGAGAAGGAGGG 0: 1
1: 1
2: 4
3: 87
4: 699
Right 1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 459
1059437073_1059437084 3 Left 1059437073 9:114283499-114283521 CCAGGAGAAGGAGGGCTGGGGCA 0: 1
1: 0
2: 5
3: 69
4: 618
Right 1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 459
1059437069_1059437084 10 Left 1059437069 9:114283492-114283514 CCTGGAGCCAGGAGAAGGAGGGC 0: 1
1: 0
2: 20
3: 81
4: 596
Right 1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 459
1059437065_1059437084 12 Left 1059437065 9:114283490-114283512 CCCCTGGAGCCAGGAGAAGGAGG 0: 1
1: 0
2: 4
3: 89
4: 666
Right 1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059437084 Original CRISPR GTGGGGAACTCCAGGGAGGA GGG Intronic
900310831 1:2032472-2032494 AAGGTGAGCTCCAGGGAGGAGGG - Intergenic
900337158 1:2169863-2169885 GGAGGGAAGTCCAGGTAGGATGG + Intronic
900587545 1:3440431-3440453 GTGGGGAGCTTCAGGGAGTGGGG - Intergenic
900755657 1:4432869-4432891 GTGGTGATCCCCAGGGATGAAGG - Intergenic
901435763 1:9246533-9246555 ATGGGCAACTCCAGGCAGGGTGG - Intronic
901523981 1:9807785-9807807 GTCAGGAAGCCCAGGGAGGAGGG - Intronic
902044011 1:13512261-13512283 GATGGGAACACCAGGGCGGAGGG - Intronic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902408600 1:16199906-16199928 GTGAGGAACAGCAGGGAGGCTGG - Intronic
902939308 1:19788447-19788469 GTGGCTAACTCCAGGTAGGCAGG + Intronic
902970516 1:20044808-20044830 GTGGAGCAGTCTAGGGAGGAGGG + Intronic
903224168 1:21885492-21885514 CTGGGGATGCCCAGGGAGGATGG - Intronic
904498084 1:30898688-30898710 GTGGGGAAGGGCAGGCAGGACGG - Intronic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
904917493 1:33980879-33980901 GTGGGGAACTTCCAGAAGGAGGG + Intronic
905264104 1:36739321-36739343 GAGGGGGACCCCAGGGAGAAGGG - Intergenic
905425596 1:37881421-37881443 GTGTGGTGCTCCAGGGAAGAGGG - Intronic
906562357 1:46768535-46768557 CTGGAGAAATCCAGGTAGGAGGG - Intronic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
907222854 1:52920292-52920314 GTGGGCAACAGCAGGGAGCAAGG + Intronic
907263285 1:53238258-53238280 GTGGGGAACTAGAGGAGGGAGGG - Intronic
907302764 1:53498809-53498831 GTGGGGGTCTCCAGCTAGGAAGG - Intergenic
907342697 1:53748117-53748139 CTGGGGAACTCCTTGGAGGCAGG + Intergenic
907437661 1:54459788-54459810 GTTGGGGCCTCCTGGGAGGATGG + Intergenic
908227704 1:62072578-62072600 ATGGTGACCTCCTGGGAGGAGGG + Intronic
908911739 1:69079306-69079328 GTAGGGAACCCCAGGGTGGGAGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909618898 1:77645456-77645478 ATGGTGATCTCCAGGGAGCAGGG + Intronic
910275514 1:85445289-85445311 GTGGGGTGCTTCAAGGAGGAGGG + Intronic
910506874 1:87959407-87959429 GTGTGCAACTGAAGGGAGGAGGG + Intergenic
911477385 1:98390265-98390287 GTGGCAAACTAGAGGGAGGAAGG + Intergenic
912392050 1:109310002-109310024 GTTTGGACCTCTAGGGAGGAGGG - Exonic
912648607 1:111418495-111418517 GTGGGAAGCACCAGAGAGGAAGG - Intronic
912946731 1:114091381-114091403 ATGGGGAAAGCCAGCGAGGAAGG + Exonic
913213521 1:116600878-116600900 GTGGGGACCTCCAGTGGGGTGGG + Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
915059637 1:153170774-153170796 GTGGGGAGGTGCAGGGAGGTAGG - Intergenic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
916881394 1:169022684-169022706 GTTGGGAACTACTGGGAGAAAGG - Intergenic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
917737624 1:177934967-177934989 GTGGGGAGCAGTAGGGAGGAGGG - Intronic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918245025 1:182651735-182651757 GTGGGGATCTCCTGGCAGGCAGG - Intronic
919462311 1:197892295-197892317 GTTGGGAACTGCTGGGAGAAGGG + Intergenic
919857568 1:201716173-201716195 GCGGGGATCTCCAGGGAAGCTGG - Intronic
920235610 1:204501816-204501838 TTGGGGAACTCTGGGAAGGAAGG + Intergenic
920388195 1:205582546-205582568 GTGGGGCTTTCCAGGGAGGTGGG - Intronic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
922466525 1:225848696-225848718 GTGGGGGAGTGCAGGGATGAGGG + Intronic
922784470 1:228276206-228276228 GTGGGGCACTGAGGGGAGGAGGG + Intronic
922887216 1:229029286-229029308 GTGGGGAAGGCAAGTGAGGACGG - Intergenic
923008750 1:230072016-230072038 GTGGGGGACACCTGGGAGGCTGG + Intronic
923111499 1:230894263-230894285 GTGGTGAATTCCTGGGAGCAGGG + Intergenic
923211918 1:231811251-231811273 GAAGGGACCTCCAGGGAGAAGGG + Intronic
923959132 1:239057078-239057100 GGAGGGAACCCCAGGGAGGGAGG + Intergenic
924048403 1:240055668-240055690 GTAGGGAACCCCAGAGAAGATGG + Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1063923275 10:10952246-10952268 GTGCGGAACTTCAGGGGGGAAGG - Intergenic
1063968982 10:11368144-11368166 GTGGGACTCCCCAGGGAGGAAGG + Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1064244428 10:13657572-13657594 GAGGGGTGCTCCGGGGAGGAGGG + Intronic
1065665903 10:28060438-28060460 GTTGGGATCTGCAGGAAGGATGG - Intronic
1066046271 10:31598225-31598247 GTGTGGAAATCCTGGCAGGACGG + Intergenic
1067181085 10:43986485-43986507 GTGGGGAAGGGCAGGGAGAATGG - Intergenic
1067658602 10:48216857-48216879 ATTGGGAAGTCCTGGGAGGAGGG - Intronic
1069622142 10:69844240-69844262 GTGTGGCTGTCCAGGGAGGATGG + Intronic
1070617902 10:77983094-77983116 GTGGGAAGCTCTAGGGAGGCTGG + Intronic
1070914108 10:80141841-80141863 GAGGTGAAGCCCAGGGAGGAAGG - Intronic
1071232705 10:83607311-83607333 CTGAGCAACTCCAGGCAGGATGG + Intergenic
1071404575 10:85317811-85317833 CTGGGGAAGTCAAGGGAAGAGGG + Intergenic
1071562520 10:86655237-86655259 ATGGAGCCCTCCAGGGAGGAGGG + Intronic
1072412138 10:95212760-95212782 GCGGGAAAGTCCAGGGAAGAGGG - Intronic
1072533351 10:96340173-96340195 GTGGGGACCTCCAGAGAACAGGG - Intergenic
1072622579 10:97089748-97089770 GTGGGGTTCACCGGGGAGGATGG + Intronic
1073338393 10:102727631-102727653 GTGGGGGACGCAGGGGAGGAAGG - Intronic
1073562364 10:104507765-104507787 GTGGGGAGATCCATGGAGTATGG + Intergenic
1074391780 10:113064011-113064033 CTAGGGAACTCCTGCGAGGAAGG + Intronic
1074548784 10:114423913-114423935 ATGGTGAACTCCAGAAAGGAGGG - Intergenic
1075429261 10:122366701-122366723 GTGGGGAACTCCAGGCAGTTGGG + Intergenic
1076431255 10:130404188-130404210 GTGGGGAAGTCCAAGGTGGAGGG + Intergenic
1076574369 10:131453957-131453979 GGGTGGAACTCCAGGCAGGGAGG - Intergenic
1076634543 10:131873832-131873854 GGGGGGAATTCCTGGGAGGCCGG + Intergenic
1076812888 10:132898467-132898489 ATGGGGCAACCCAGGGAGGACGG - Intronic
1077118417 11:895879-895901 GTGGGGAGCTGCAGGAAGGTCGG - Intronic
1077159220 11:1105072-1105094 GTGGGGAAGGCCAGGCTGGAGGG + Intergenic
1077403245 11:2369240-2369262 GGAGGGGACCCCAGGGAGGAGGG - Intergenic
1077937689 11:6806419-6806441 GTGGGTTACTAGAGGGAGGAGGG - Intergenic
1080386822 11:31815387-31815409 GAGGGGATATCCAGGGAGAAGGG - Intronic
1080793979 11:35546440-35546462 GTGAGCAGCCCCAGGGAGGATGG - Intergenic
1081962811 11:47150785-47150807 GTGGGGGAGTCGAGGGAGGCAGG + Intronic
1082833638 11:57637656-57637678 GTGGGGGAGCCCAGAGAGGAAGG - Intergenic
1083248182 11:61446459-61446481 GCGGGGAGCTGCAGGGAGGGCGG - Exonic
1083592371 11:63903260-63903282 GGATGGAACTCCAGGGAGCAGGG - Intronic
1083652275 11:64210557-64210579 GTTGGGGGCACCAGGGAGGAAGG + Intronic
1084431005 11:69111216-69111238 GTGAGGACCACCAGGAAGGAAGG + Intergenic
1084682640 11:70675784-70675806 CTGGGTAATGCCAGGGAGGAAGG + Intronic
1084758910 11:71256067-71256089 GTGGGGAGCAGCAGGCAGGAGGG + Intergenic
1085821685 11:79800763-79800785 TGGGGGAAATCTAGGGAGGAGGG - Intergenic
1086079849 11:82891625-82891647 GGGAGGAACTGTAGGGAGGATGG - Intronic
1086123629 11:83327222-83327244 GTGGGAAAGGCCAGGGAAGAAGG + Intergenic
1087301554 11:96442143-96442165 GTGGAGAATCCCAGAGAGGAGGG + Intronic
1088817056 11:113428586-113428608 GTGGAGAACTTCCTGGAGGAGGG + Intronic
1089018854 11:115190401-115190423 GTGGGGAAGGGCAGGGAGGAGGG - Intronic
1090761468 11:129840408-129840430 ATGAGGAAGTGCAGGGAGGAGGG + Intronic
1091074352 11:132601223-132601245 GAGGGGCAGACCAGGGAGGAGGG - Intronic
1091172610 11:133531867-133531889 GTTGGGACCTGCAGGGTGGAAGG - Intronic
1092398147 12:8146520-8146542 GAGAGGAACTCCTAGGAGGAGGG + Intronic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1092981476 12:13799223-13799245 GTGGGGACCTGCAGGGGGAAGGG - Intronic
1093546878 12:20359204-20359226 ATGGAGCACTCCAGTGAGGAAGG + Intergenic
1094417916 12:30236718-30236740 ATGGTGAACACCAGGAAGGAGGG + Intergenic
1095631696 12:44384401-44384423 GTGGGGAAGTGCAGAGGGGAAGG - Intronic
1095635522 12:44428889-44428911 TTGGGGAACTGCAGTGAGCAAGG + Intergenic
1095858222 12:46885463-46885485 GTGAGGAACTACAGGGAGCAAGG - Intergenic
1096154329 12:49333338-49333360 CTGGGGAGGACCAGGGAGGAGGG + Intronic
1096177844 12:49534862-49534884 CTGGGGACCTCCAGAGAGGAAGG + Intergenic
1096497504 12:52046979-52047001 GTGGGGAACTGCGGTGATGAGGG + Intronic
1096707435 12:53431152-53431174 GGGGGGAATGACAGGGAGGAAGG - Intronic
1096792628 12:54054397-54054419 GTGGGGAGCGCTAGGGAAGAAGG - Intronic
1097882378 12:64698096-64698118 CTGGGGAACCACAGGGACGATGG + Intergenic
1101938453 12:109080093-109080115 GGGGGAAACTCCAGGGAGCCTGG - Intronic
1102569778 12:113820434-113820456 GTGGGAGCCTGCAGGGAGGAAGG + Intronic
1102889167 12:116544742-116544764 CTGGGGAACACTAGGGAGGTAGG - Intergenic
1103557583 12:121775586-121775608 CTGGGGGAGTCCAGAGAGGAGGG - Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103711818 12:122918277-122918299 GGGGGGCACCCAAGGGAGGAAGG - Intergenic
1103871260 12:124093872-124093894 GTGGGGAAGTCAAGTGGGGAAGG + Intronic
1103915903 12:124375636-124375658 CTGGGGACCTCCAGGCAGAAAGG - Intronic
1104088225 12:125494289-125494311 GTGGCCATTTCCAGGGAGGAGGG - Intronic
1104088412 12:125494837-125494859 GTGGCCATTTCCAGGGAGGAGGG - Intronic
1104269396 12:127268892-127268914 GTGAGGCACTCCAGGGCAGAGGG - Intergenic
1104720837 12:131044372-131044394 GGGGGGAACTCGTGGGTGGACGG - Intronic
1105060307 12:133144205-133144227 GTGTGGAACTCCAGAGATTAAGG + Intronic
1105216758 13:18291434-18291456 GTGGGGACCTCCAGTGGGGTGGG + Intergenic
1105892061 13:24689020-24689042 GGAGGGATCTCCAGGCAGGATGG + Intronic
1106370423 13:29127238-29127260 GAGGGGAAATCCAGGGAGTGTGG - Intronic
1108818997 13:54322408-54322430 GGGGGGTACTCGAGGGTGGAGGG + Intergenic
1111898534 13:94171563-94171585 GAAGGGAACTCTAGGGAGAATGG + Intronic
1112464552 13:99632144-99632166 GAGGGAAACCCCAGAGAGGAGGG + Intronic
1112609954 13:100946284-100946306 GTGGGGAACTGGATGGAGCAAGG - Intergenic
1112621510 13:101058375-101058397 AAGGGGAACTGCAGGAAGGAAGG + Intronic
1112665127 13:101561294-101561316 GTGGGGAACTCAAGGAAGAGAGG + Intronic
1113279860 13:108777513-108777535 GTGGGGAAATTCACGGAGGCTGG + Intronic
1113853140 13:113429266-113429288 ATGGGGAGTTCCAGGGAGGATGG - Intronic
1113861779 13:113491326-113491348 GAGGGGAGCCCCAGGGAGGGAGG - Intronic
1113861816 13:113491414-113491436 GAGGGGAGCCCCAGGGAGGGAGG - Intronic
1113861852 13:113491497-113491519 GAGGGGAGCCCCAGGGAGGGAGG - Intronic
1114483422 14:23048898-23048920 GTGGGAAAATCCAGGTATGAGGG + Intronic
1115277946 14:31629119-31629141 TTGGGGATCTCCAGAGAGAAAGG + Intronic
1115495623 14:34001539-34001561 CTGGGGCTTTCCAGGGAGGAAGG + Intronic
1117971476 14:61255016-61255038 GTGTGGGACTGCAGTGAGGATGG - Intronic
1118375207 14:65170914-65170936 GTGGTGAGTTCCAGCGAGGAGGG + Intergenic
1118912167 14:70070612-70070634 GTGGGAAGTTCCAGGGAGGTGGG + Intronic
1119409616 14:74422229-74422251 GGGGGCAGCTGCAGGGAGGAAGG + Intronic
1119647921 14:76361814-76361836 TTGGGGAACTCCAGGGAAGGTGG + Intronic
1119679586 14:76582151-76582173 GTGGGCGTGTCCAGGGAGGATGG + Intergenic
1121013442 14:90534842-90534864 GTGGAGAACTCCAAGGATGATGG + Exonic
1121253113 14:92513996-92514018 GTGGGGATCGCGAGGGAGGAGGG - Intronic
1121285447 14:92731985-92732007 GTGGGGAAATCCAGGAAAGATGG + Intronic
1121925386 14:97922646-97922668 GTGGTGGACTCCAGGAATGAAGG + Intergenic
1122007520 14:98717758-98717780 TTGGGGAATTCCTGGGAGGTGGG - Exonic
1122117230 14:99533843-99533865 GGGGGGCACCCCAGGAAGGAAGG + Intronic
1122195059 14:100078629-100078651 GTGGGGAACAGCAGGAAGTAGGG + Intronic
1122769909 14:104093301-104093323 GTGGGGAGCTCCAGGTGGAAGGG + Intronic
1122867206 14:104611886-104611908 GCTGGGGACCCCAGGGAGGAGGG + Intergenic
1123459801 15:20459503-20459525 CTGGCGAACTCCAGGGCAGAGGG - Intergenic
1124071084 15:26393653-26393675 TAGGGGCACTGCAGGGAGGAGGG + Intergenic
1124405025 15:29384605-29384627 CTGGGCACCTCCAGGGAGGCTGG + Intronic
1125338109 15:38647952-38647974 GTGGGGAGTTGCAAGGAGGAGGG + Intergenic
1125364946 15:38903594-38903616 GTGAGGAATGCCTGGGAGGAGGG - Intergenic
1126284629 15:46996832-46996854 CTGCGGAGCTCCTGGGAGGAGGG - Intergenic
1126383834 15:48074117-48074139 TTGGGAAAATCCAGGGAGCACGG + Intergenic
1126582858 15:50257323-50257345 GGGGGAAACTCCATGGAGAACGG + Intronic
1126685115 15:51241608-51241630 GAGGAGAAATCCAGTGAGGAAGG + Intronic
1127303800 15:57682824-57682846 GATGGGAACTCCAGGAAGAAGGG - Intronic
1128153284 15:65376833-65376855 GTGGGGAACTTGAGGTGGGAGGG + Intronic
1130411335 15:83650986-83651008 GTGGGGCACTCCTTGGAGGCTGG + Intergenic
1130955704 15:88626059-88626081 GTGGTGCACTGCAGGGAGGGAGG + Intronic
1130982178 15:88820329-88820351 ATGGGGGACTTCATGGAGGAAGG + Intronic
1132142252 15:99405718-99405740 GGGGGGAGCTCCAGGGAGAATGG - Intergenic
1132275890 15:100563633-100563655 GGGGAGAAGGCCAGGGAGGATGG + Intronic
1132313917 15:100877479-100877501 GTGGTGCAGTGCAGGGAGGAGGG - Intergenic
1132810232 16:1793715-1793737 GTGGGGAAATCCAGAGGGCAGGG - Exonic
1132810393 16:1794173-1794195 GTAGGGAACCCCCGGGAGGGCGG - Intronic
1132871994 16:2119478-2119500 GTGGGGAGCTCAAGGGTGGGAGG - Intronic
1133030767 16:3009960-3009982 GGGGGGACTTCCAGGGAGGCAGG + Intergenic
1133271474 16:4612809-4612831 GTGGGGGCCGCCAGGGAGGCTGG - Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133591241 16:7246333-7246355 GTGGGGGATGCCAGGGAGCAAGG - Intronic
1133597185 16:7304130-7304152 GCGGGGAGAGCCAGGGAGGAGGG + Intronic
1133668115 16:7990709-7990731 GTTGGGAACGGCAGTGAGGAAGG - Intergenic
1134167574 16:11942724-11942746 GTGGGGAGCTCCAAGCAGGTGGG + Intronic
1134493127 16:14710988-14711010 GTGGGGAGCTCCAAGCAGGTGGG - Intronic
1134498508 16:14750112-14750134 GTGGGGAGCTCCAAGCAGGTGGG - Intronic
1134520533 16:14917418-14917440 GTGGGGAGCTCAAGGGTGGGAGG + Intronic
1134525060 16:14936742-14936764 GTGGGGAGCTCCAAGCAGGTGGG - Intronic
1134547835 16:15124177-15124199 GTGGGGAGCTCCAAGCAGGTGGG + Intronic
1134551041 16:15138556-15138578 GTGGGGAGCTCAAGGGTGGGAGG - Intronic
1134582068 16:15378973-15378995 GTGGGGAGCTCCAAGCAGGTGGG + Intronic
1134708205 16:16316069-16316091 GTGGGGAGCTCAAGGGTGGGAGG + Intergenic
1134712650 16:16335229-16335251 GTGGGGAGCTCCAAGCAGGTGGG - Intergenic
1134715420 16:16356102-16356124 GTGGGGAGCTCAAGGGTGGGAGG + Intergenic
1134720514 16:16378544-16378566 GTGGGGAGCTCCAAGCAGGCGGG - Intergenic
1134946913 16:18333341-18333363 GTGGGGAGCTCCAAGCAGGCGGG + Intronic
1134951397 16:18352576-18352598 GTGGGGAGCTCAAGGGTGGGAGG - Intergenic
1134954177 16:18373464-18373486 GTGGGGAGCTCCAAGCAGGTGGG + Intergenic
1134959337 16:18396057-18396079 GTGGGGAGCTCAAGGGTGGGAGG - Intergenic
1135313001 16:21420376-21420398 GTGGGGAGCTCCAAGCAGGTGGG + Intronic
1135365925 16:21852656-21852678 GTGGGGAGCTCCAAGCAGGTGGG + Intronic
1135445890 16:22518506-22518528 GTGGGGAGCTCCAAGCAGGTGGG - Intronic
1136152159 16:28358108-28358130 GTGGGGAGCTCCAAGCAGGTGGG + Intronic
1136194589 16:28643075-28643097 GTGGGGAGCTCCAAGCAGGTGGG - Intronic
1136210921 16:28757174-28757196 GTGGGGAGCTCCAAGCAGGTGGG - Intronic
1136255643 16:29037133-29037155 GTGGGGAGCTCCAAGCAGGTGGG - Intergenic
1136309671 16:29399104-29399126 GTGGGGAGCTCCAAGCAGGTGGG + Intronic
1136316898 16:29459830-29459852 GCTGGGAACTCCAGGAAGGAAGG - Intergenic
1136323114 16:29500884-29500906 GTGGGGAGCTCCAAGCAGGTGGG + Intronic
1136431473 16:30199172-30199194 GCTGGGAACTCCAGGAAGGAAGG - Intronic
1136437798 16:30240852-30240874 GTGGGGAGCTCCAAGCAGGTGGG + Intronic
1136535000 16:30894045-30894067 GCGGCCAACTCCAGGGGGGACGG - Exonic
1136713463 16:32258719-32258741 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1136754448 16:32670712-32670734 GTGGAGAACTCCAGCTGGGAGGG - Intergenic
1136813665 16:33199653-33199675 GTGGAGAACTCCAGCTGGGAGGG + Intronic
1136820141 16:33309733-33309755 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1136826704 16:33366272-33366294 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1136831770 16:33465043-33465065 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1137010485 16:35315763-35315785 GTGGAGAACTCCAGCTGGGAGGG - Intergenic
1137024090 16:35456058-35456080 GTGGAGAACTCCAGCTGGGAGGG - Intergenic
1138026481 16:53526125-53526147 GCGGGGAACTCGAGTGAGGAGGG + Intergenic
1138069785 16:53981371-53981393 TTGGGGAACACCAGGGAATATGG - Intronic
1138536747 16:57664195-57664217 GAGGAGAACCCCAGGGAAGATGG - Exonic
1139857353 16:69991483-69991505 GTGGGGAGCTCCAAGCAGGTGGG + Intergenic
1140127318 16:72128923-72128945 GTGGGAAAGGCCAGCGAGGAGGG - Intronic
1140365320 16:74376437-74376459 GTGGGGAGCTCCAAGCAGGTGGG - Intergenic
1140711756 16:77685416-77685438 GTGGGGACTGCCAGGAAGGAAGG + Intergenic
1141185372 16:81783202-81783224 GTGGGGAACTCCAGGATGCATGG + Intronic
1141597016 16:85103571-85103593 GTGGGCAGCACCAGGGAGCATGG - Intronic
1141666802 16:85469942-85469964 GCGGGGAACCACAGTGAGGATGG - Intergenic
1141693191 16:85607829-85607851 GTGGGGGCCTCAAGGGAAGAAGG - Intergenic
1141743949 16:85913509-85913531 CTGGGAAAGTCCAGGGAAGAGGG + Intronic
1142029134 16:87829735-87829757 GTGGAGACCACCGGGGAGGAGGG - Intergenic
1142194685 16:88733950-88733972 GAGGAGGACTCCAGGGACGAGGG - Exonic
1142206080 16:88784018-88784040 GTGGGGAGCCCCCGGGCGGAGGG + Intronic
1142287522 16:89177466-89177488 GAGGGGGCCTCCAGGGAGGAGGG + Intronic
1142343829 16:89541450-89541472 GGGGAGGTCTCCAGGGAGGAGGG + Intronic
1202992241 16_KI270728v1_random:22627-22649 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1203056595 16_KI270728v1_random:931043-931065 GTGGAGAACTCCAGCTGGGAGGG - Intergenic
1142698803 17:1647603-1647625 GTGGTGAGATCCAGGGAGAAGGG + Intronic
1144455312 17:15413609-15413631 GTGGCCAACTCCAGGGAAAAAGG + Intergenic
1144946525 17:18972209-18972231 GTGGGCAGCTCCAGGGAGCATGG + Intronic
1145850747 17:28093172-28093194 GAGGGGAGTTGCAGGGAGGAGGG + Intronic
1146596476 17:34173404-34173426 GTGGGGAAATGCAAGGAGGAGGG + Intronic
1146662579 17:34674480-34674502 GAGTGGGACACCAGGGAGGATGG - Intergenic
1147258910 17:39197437-39197459 ATGGGGATCTCCTGGGAGGGTGG + Exonic
1147572485 17:41579949-41579971 GTGGGGAAATCCCGGGAGGAGGG + Intergenic
1147635366 17:41960701-41960723 ATTGGCAACTCCAGGTAGGAAGG + Intronic
1147691223 17:42315955-42315977 GCAGGGTCCTCCAGGGAGGAGGG - Intronic
1148690078 17:49522010-49522032 GTGGGGAGCTCAGGGGAGGAGGG + Intergenic
1148823206 17:50372991-50373013 GTGGGGTACTCCAGGTTTGAGGG - Intronic
1149685194 17:58531183-58531205 CTGGGCACCTCCAGGGAGGCTGG + Intronic
1151350165 17:73527145-73527167 CAGGGGAGCTCCAGGGAGGAAGG + Intronic
1151854115 17:76709733-76709755 GTGGTGAACTCCAGGGAACATGG + Intronic
1152124305 17:78437264-78437286 GTGGGGTACTCCCTGGAGGCTGG - Intronic
1152420208 17:80188696-80188718 CTGGGGAACAGCAGGAAGGAAGG - Intronic
1152689222 17:81710381-81710403 GTGAGACACTCCAGGAAGGAGGG - Intergenic
1153732513 18:8029147-8029169 GGAGGGAACTCCAGGCAGGCAGG - Intronic
1154016183 18:10619960-10619982 GTGTGGAAGTCCATGGAGAAGGG + Intergenic
1154114366 18:11598200-11598222 GTTGAAAACTCCAGGGAGTATGG + Intergenic
1154118800 18:11634731-11634753 GTGGGGAGCTCCAAGCAGGTGGG + Intergenic
1154189331 18:12215691-12215713 GTGTGGAAGTCCATGGAGAAGGG - Intergenic
1155212987 18:23619146-23619168 GTCTGCAGCTCCAGGGAGGAGGG + Intronic
1155283606 18:24266214-24266236 GTGGGGAAAGCCAGGGAGGAAGG - Intronic
1155549349 18:26948809-26948831 GAGGGGCACTCCAGGGAGTTGGG + Intronic
1156253157 18:35371479-35371501 GTTGAGAAGTCCAGGGTGGAGGG + Intronic
1156297704 18:35807978-35808000 GCTGGGACCTCCAGGGAGCATGG - Intergenic
1156297885 18:35809178-35809200 GTGGAAAACTAGAGGGAGGAAGG - Intergenic
1157304827 18:46509321-46509343 GGTGGGAACTTCAGGCAGGATGG - Intronic
1158553631 18:58458039-58458061 TTGAGGAACTGCAGGGATGAGGG - Intergenic
1158567911 18:58570718-58570740 GTGGGCAAATCCAGGAAAGACGG + Intronic
1159632518 18:70765298-70765320 ATAGAGACCTCCAGGGAGGAAGG + Intergenic
1160038206 18:75320615-75320637 GTGGGTAACTCAGGGCAGGAAGG - Intergenic
1160679284 19:405372-405394 GCGGTGAACTCCAGGGAGGAAGG - Intergenic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1161297220 19:3526198-3526220 GTGGGGGCCTGCAGGGCGGATGG - Intronic
1161469331 19:4448405-4448427 GTGGAGAAGTGCTGGGAGGAGGG + Exonic
1161593179 19:5137842-5137864 CTGGGGAACTTCAGGAAGGTCGG - Intronic
1161676255 19:5651706-5651728 CTGGGAAACACCAGGGAGGAAGG - Intronic
1162750292 19:12825568-12825590 CTCTGGAGCTCCAGGGAGGAGGG + Exonic
1163414324 19:17176737-17176759 TTGGGCCACTCCAGGCAGGATGG - Intronic
1163737583 19:18990732-18990754 GTGGGGCAAGCCAGTGAGGAGGG + Intergenic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1164557996 19:29268377-29268399 GTGGGCAGCTCCAGGGAGGGCGG + Intergenic
1165189327 19:34049329-34049351 CTGGGTGACTCCAGGAAGGAAGG + Intergenic
1165315466 19:35052743-35052765 CTGGCGAACTCCAGGAAGGCAGG + Intronic
1165810311 19:38607967-38607989 GTCAGGGACCCCAGGGAGGATGG - Intronic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166356797 19:42232090-42232112 CTGGGGACCTCAAGTGAGGAGGG + Exonic
1166528779 19:43529882-43529904 TTGGGGAACTCAGGGGAGGGAGG + Intronic
1166752192 19:45169640-45169662 GAGGAGAACCCCAGGAAGGAAGG + Intronic
1167597646 19:50435865-50435887 GAGGGGAACCCGGGGGAGGAGGG + Intronic
925149665 2:1606511-1606533 GTGGGGAACTCAGGGAAGGCTGG + Intergenic
925913935 2:8590810-8590832 GTGGGGAATTTCTGGGTGGATGG - Intergenic
926547878 2:14264278-14264300 GTGGGGAATGCCAGACAGGAAGG + Intergenic
926703293 2:15818526-15818548 GAGGGTACCTCCAGGAAGGACGG + Intergenic
927515257 2:23668536-23668558 CTGCAGAAGTCCAGGGAGGAGGG + Intronic
928369727 2:30732236-30732258 ATGGGGAACTACAGGGGAGAGGG + Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929574295 2:43042319-43042341 GAGGGGAACTCCGGGGAGGGAGG + Intergenic
930347955 2:50209146-50209168 GTGGAGTACTCCAGGGGTGAAGG - Intronic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
932713669 2:74086091-74086113 GGCGGGAACTCCACGCAGGATGG - Intronic
933052954 2:77623115-77623137 GTGGGAAAAACCAGGGAGGCAGG + Intergenic
934297569 2:91755244-91755266 GTGGGGACCTCCAGTGGGGTGGG - Intergenic
935068449 2:99673299-99673321 GTGGGGAAAACCAAGCAGGAGGG + Intronic
935737903 2:106120795-106120817 GTTAGGGACTCCAGGGTGGAAGG + Intronic
936514576 2:113173776-113173798 GTGGGGGCCTCCAAGGAGCAGGG + Intronic
937356331 2:121200220-121200242 GTGTGGCACTCCAGGGAGGCTGG + Intergenic
938265612 2:129926006-129926028 GAGGTGAAGCCCAGGGAGGAAGG + Intergenic
940886534 2:158994511-158994533 TTGGGGAAGCCAAGGGAGGAAGG - Intronic
942142687 2:172993755-172993777 GTGGGGGACTCCAAGATGGAGGG - Intronic
942501072 2:176591717-176591739 GTGGGGACCTCAGGTGAGGATGG + Intergenic
943680150 2:190759930-190759952 TTGTGGAACTCTTGGGAGGAGGG + Intergenic
944108798 2:196108794-196108816 GTGGGGAACTGAGGTGAGGATGG - Intergenic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
946307892 2:218866245-218866267 GTGGGGAAATAGAGGGAGGCTGG + Intronic
946391161 2:219417867-219417889 GTGGGGGTCTCTAGGCAGGAAGG - Intergenic
946864574 2:224031422-224031444 CTGGGGAACGCCAGGCAGCACGG + Intronic
947079583 2:226381188-226381210 CTGGGGTTCTCCAGAGAGGAAGG - Intergenic
947491748 2:230601843-230601865 GTGGCTGAATCCAGGGAGGAGGG - Intergenic
948578927 2:238971120-238971142 CTGGGGTATTCCTGGGAGGATGG - Intergenic
948650266 2:239439509-239439531 GTGGAGAATTCTAGGGAGGTTGG + Intergenic
948666995 2:239542342-239542364 ACTGGGAATTCCAGGGAGGAAGG - Intergenic
1168841781 20:914406-914428 AGAGGGAACTCCAGGGAGTAAGG + Intronic
1169187230 20:3628995-3629017 GTGGGGAACACCGGTGAGGAAGG - Intronic
1169778172 20:9278941-9278963 GTGGGGAACTCCATGAGGGCAGG - Intronic
1171021049 20:21584426-21584448 GTGGGGCTCCCCAGGGAAGATGG - Intergenic
1171237683 20:23540904-23540926 GAGGGGGAATCCAGGGACGAGGG - Intergenic
1171400543 20:24870764-24870786 GTCGGTAGGTCCAGGGAGGAGGG - Intergenic
1171426606 20:25052443-25052465 ATGGGGACCACCAGGGAGCATGG - Intronic
1171486656 20:25490725-25490747 GTGGGGGACTGCAGTGAGAAGGG + Intronic
1172035942 20:32010764-32010786 GCGGGGAACACCAGGGAAGCAGG - Intronic
1172269640 20:33647126-33647148 GTGGGGAACTCTAAGGGGGACGG + Exonic
1173375069 20:42475747-42475769 GAGGTGAGCTCCAGGGAGAATGG - Intronic
1174133145 20:48359914-48359936 GTGAGGAACAGCAGGGAGGTGGG - Intergenic
1175072259 20:56344388-56344410 TTGGGGAAGTTAAGGGAGGATGG - Intergenic
1175215438 20:57389850-57389872 GTGGGAAACTCCGCGAAGGAAGG + Intergenic
1175222492 20:57425472-57425494 CTGAGGAACTGCAGGGAGGCCGG + Intergenic
1175246656 20:57586244-57586266 GTGGGGAACACCAGGGAAGCTGG + Intergenic
1175260370 20:57670278-57670300 CTGGGCCACTCCAGGGAGGAAGG + Intronic
1175440837 20:58990014-58990036 GTGGGGAGCACTAGGAAGGAAGG - Intronic
1175960522 20:62634305-62634327 GTGGGGTCCTCAAGGGAGGGGGG + Intergenic
1176034738 20:63030694-63030716 TTGGGGACCTCCACGCAGGATGG + Intergenic
1176514549 21:7774280-7774302 GAGGGGAAGTCCCGGGAGGCTGG - Intergenic
1176656285 21:9591409-9591431 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1178648662 21:34404804-34404826 GAGGGGAAGTCCCGGGAGGCTGG - Intronic
1179416016 21:41199333-41199355 GGAGGGAGCCCCAGGGAGGAGGG + Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179821641 21:43940450-43940472 CAGGGGAACTCCTGGGAGGTAGG + Intronic
1180169374 21:46050014-46050036 GTGTTGACCTCCAGGGATGAGGG - Intergenic
1181437192 22:22917851-22917873 GTCAGGAATGCCAGGGAGGAAGG - Intergenic
1181582857 22:23837555-23837577 GAGGAGAACTCCAGCAAGGATGG + Intronic
1181746783 22:24960761-24960783 ATGTGGAACTTTAGGGAGGAAGG + Intronic
1181934354 22:26428591-26428613 GAGGGGAAGTACAGGCAGGACGG - Intergenic
1183329443 22:37211700-37211722 GTGGGGACTCCCAGGGAGGCAGG - Intronic
1183484963 22:38083800-38083822 GAGGGACACTCCAGGCAGGAGGG - Intronic
1183642996 22:39103629-39103651 GTGGGACACCACAGGGAGGAAGG - Intronic
1183829555 22:40410527-40410549 GTGGAGAGCTCCTGGCAGGAAGG + Exonic
1184641981 22:45877694-45877716 GTGGGGAGCCCCAGGGTGGCAGG - Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
951297196 3:20952468-20952490 GTGGGGAAGGGTAGGGAGGAGGG + Intergenic
952739425 3:36721210-36721232 GTGGGGAACTCAAGCAAGCAAGG - Intronic
953237879 3:41121830-41121852 GTGGAGGACTACTGGGAGGAGGG + Intergenic
953617425 3:44503612-44503634 CTTGGGAAATCCAGAGAGGAAGG - Intronic
954329484 3:49881950-49881972 TTGGATAGCTCCAGGGAGGAAGG - Intergenic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
957590194 3:82186470-82186492 GTGGGCAGCTCCAAGGAGGTGGG - Intergenic
958503784 3:94946882-94946904 CTAAGGAACTCCAGGGGGGAGGG - Intergenic
960496006 3:118375664-118375686 AGAGGTAACTCCAGGGAGGAGGG - Intergenic
961378469 3:126482294-126482316 GTGAGGATCGCCAGGGAGGAAGG + Exonic
961592510 3:127991327-127991349 GTTGGAAACCCCAGCGAGGAGGG + Intergenic
961650794 3:128415837-128415859 GTGAGGAACTCCAGGAAGCAGGG - Intergenic
963773729 3:149417069-149417091 GAGGGGAACTGCATGGCGGAGGG + Intergenic
965370413 3:167855277-167855299 GTTGAGATCTCCAGGGAGGTGGG + Intergenic
966903421 3:184504092-184504114 GTGGGGCACTCCAGGTAATAAGG + Intronic
967299160 3:187995388-187995410 GTGGGGAAGTGCAGGGATGCAGG + Intergenic
967312617 3:188120350-188120372 GTGGAGAATTCCAGTGAGAAAGG + Intergenic
967836073 3:193963983-193964005 GGAGGGCATTCCAGGGAGGAGGG - Intergenic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968972255 4:3802185-3802207 CTGGGGCACCCCAAGGAGGATGG + Intergenic
968982110 4:3855850-3855872 TGGGGGAACTCCTGGGAGGCCGG - Intergenic
971910670 4:32792985-32793007 GTGGGGAACTTCAGGGAAGGTGG - Intergenic
972399620 4:38688762-38688784 GACGGGAACTTCAGAGAGGAGGG - Exonic
974549253 4:63349721-63349743 GTAGGCACCACCAGGGAGGATGG - Intergenic
975409750 4:74036890-74036912 GTGGGGAACTGGAGGGTGGGGGG - Exonic
978534600 4:109747781-109747803 GTGGAAAACTCGGGGGAGGAGGG + Intronic
978856162 4:113397286-113397308 GTGAGCAAAACCAGGGAGGAGGG + Intergenic
980829083 4:138107995-138108017 GTGGAAAGCTCCAGGAAGGAGGG - Intergenic
981106240 4:140885040-140885062 GTTGGTATCTCCATGGAGGAAGG + Intronic
981600898 4:146487380-146487402 GTGGGGAGCTCTAGGGTGCAAGG - Intronic
983497610 4:168461018-168461040 GTTGGGAAGTCCTGGGAGGGTGG - Intronic
983853700 4:172615486-172615508 GTGATAAACTCCAGGGAGTAAGG - Intronic
986799200 5:11241994-11242016 ATGGGGGCCTCCAGAGAGGACGG + Intronic
987154165 5:15071170-15071192 GTGGGGAATTTCAGGGAACAAGG + Intergenic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
990830954 5:59956290-59956312 GTGAGGAACTGCAAGGGGGAAGG - Intronic
992738487 5:79748289-79748311 GTGGGGAATTACTGGGACGAAGG - Intronic
992911364 5:81398906-81398928 CTGGGGAAAGCCAGGGAGGCAGG - Intergenic
993564029 5:89450405-89450427 GTGGGGAGCTAGAGGGATGAGGG + Intergenic
996029380 5:118687873-118687895 TTGGGAAAGTCCAGGGAGCAGGG - Intergenic
996635716 5:125686969-125686991 TTAGGAAACTCCAAGGAGGATGG + Intergenic
997020196 5:129991207-129991229 GTGGGGAATTCATTGGAGGAAGG + Intronic
999204909 5:149840848-149840870 ATGTGGCACTTCAGGGAGGAGGG + Intronic
999479371 5:151932537-151932559 GAGGGATACTTCAGGGAGGAAGG - Intergenic
1000309668 5:160029914-160029936 GTGGGGCCCACCAGAGAGGAGGG + Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000706645 5:164521057-164521079 GTGGTGAGGTACAGGGAGGATGG - Intergenic
1002338727 5:178500061-178500083 GTGGGGAGGTACAGGGAGGAAGG + Intronic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1003311865 6:4975649-4975671 CAGGGGGAGTCCAGGGAGGAAGG - Intergenic
1003594735 6:7464165-7464187 ACTGAGAACTCCAGGGAGGATGG + Intergenic
1003594913 6:7465840-7465862 ACTGAGAACTCCAGGGAGGATGG + Intergenic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1006409949 6:33867372-33867394 GTGGGGCAGTCCAGGGAGTTGGG + Intergenic
1006443462 6:34066000-34066022 GTGGGGTAGCCCAGGGAGGAGGG - Intronic
1006473577 6:34241618-34241640 GTGGGGCACCCTAGGGAGCATGG + Intronic
1006836668 6:37003012-37003034 GAGAGGAACACCAGGGAGGGAGG + Intergenic
1007227965 6:40328110-40328132 GTGGGGAAATCTAGGGAAGGTGG - Intergenic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1007444588 6:41895250-41895272 GTGGGTAGCTCCAGGGGGTAGGG - Intronic
1007776201 6:44225777-44225799 GAGAGGAACTACAGGGAGGTGGG + Intronic
1011734891 6:90300381-90300403 GTGGGGAAGTGCAGGGAGGCTGG + Intergenic
1013286697 6:108688083-108688105 GTGGATAACTCCAAGTAGGAAGG + Intergenic
1013826343 6:114215488-114215510 ATGGGGAAATCCAGGCAGCAGGG - Intronic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1016442200 6:144095732-144095754 GCGGGGATCTCCATGGAGGGGGG - Intergenic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG + Intronic
1019115300 6:169755799-169755821 ATGGGGAACTGAAGGGAGTATGG + Intronic
1019303894 7:323079-323101 GTCGGGAAATCCAGGCAGGTGGG + Intergenic
1019321178 7:416005-416027 GTCGGGGACGCCAGGGAGGCAGG + Intergenic
1019479715 7:1260994-1261016 GTGGAGAACGCCAGGGAGGGAGG - Intergenic
1019646211 7:2130364-2130386 CTGGGGAACTCCTGGGAGTTGGG - Intronic
1019907422 7:4075212-4075234 GTGGGGAGCTCCAAGGAACAAGG - Intronic
1020006867 7:4787973-4787995 GTGAGGCACTCCAGGGTGCAGGG - Intronic
1020137785 7:5596234-5596256 CTGGGGAACGCCAGCCAGGAAGG + Intronic
1022036414 7:26538551-26538573 GGGAGGAACTCCAGGGAGAATGG - Exonic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022247272 7:28572578-28572600 CAGGAGAACTCCAGGGGGGAAGG - Intronic
1022624542 7:32021197-32021219 GTGGGAAAATCCAGGCAGAAAGG - Intronic
1024534167 7:50416464-50416486 TTGGGGAGCTCCAGGGAGCAAGG - Intergenic
1025035478 7:55590535-55590557 GTGGGGGACCCCAGGAAGAAGGG + Intergenic
1026804663 7:73422380-73422402 GTGGGGAACCCCCGGGAGGCTGG + Intergenic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1030605340 7:111633649-111633671 GTGCAGCACACCAGGGAGGAGGG - Intergenic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1031974095 7:128083006-128083028 GTGGTGGGCTCCAGAGAGGAAGG + Intronic
1033885600 7:145941170-145941192 GAGGGGAACAGCAGGGTGGAGGG - Intergenic
1034260558 7:149752804-149752826 ATGGGGAAGCCCAGGGAGGCCGG + Intergenic
1034264417 7:149774023-149774045 GTCGGGAGCTCCAGGGGGCAAGG + Intergenic
1034377528 7:150659265-150659287 GTGGGGCAGCCCAGGGAGGAGGG - Intergenic
1034471489 7:151256975-151256997 TGGGGGAACTCCAGGGAAGAGGG - Intronic
1034578785 7:152025333-152025355 GTGGTGACCTCCCGGGAGCAGGG - Intergenic
1035028751 7:155844063-155844085 GTGGGGAACTCCATGAAGAGTGG + Intergenic
1035097039 7:156364256-156364278 GTGGGCACCTCCAGGAAGGTGGG + Intergenic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035369263 7:158368664-158368686 GGGGGGCTCCCCAGGGAGGAAGG + Intronic
1035746898 8:1967484-1967506 GTGGGGGTGCCCAGGGAGGAGGG - Intergenic
1036203890 8:6791413-6791435 GTGGGGTAAACCACGGAGGAAGG + Intergenic
1036259653 8:7229462-7229484 GTGGGGAAGGTCAGGGAGTACGG - Intergenic
1036311696 8:7688032-7688054 GTGGGGAAGGTCAGGGAGTACGG - Intergenic
1036694317 8:10964734-10964756 CTGGGGAAATCAAGGGATGAGGG - Intronic
1037778233 8:21849566-21849588 GTAGGACACACCAGGGAGGAGGG + Intergenic
1040972700 8:53154363-53154385 GTGGGGAGAGCCAGGGAGCAGGG + Intergenic
1042737108 8:72001752-72001774 GAGAGGAACTCAAGGTAGGATGG - Intronic
1044486410 8:92759621-92759643 GTTGAAAACTCCTGGGAGGAAGG + Intergenic
1045057992 8:98385544-98385566 CTGAGGACCTCCAGGAAGGAGGG + Intergenic
1045412708 8:101934569-101934591 GTCGGGAGCTTCAGGAAGGAGGG + Intronic
1045547937 8:103144525-103144547 GTGGGGGTCTCCAAGGAGAAAGG + Intronic
1047532402 8:125688874-125688896 GTGGGGAAGTCCAAGGTCGAGGG + Intergenic
1049418404 8:142505893-142505915 GTGGGCAGCTGCAGGGAGGTGGG + Intronic
1049662835 8:143828026-143828048 GAGGGGCACTCCAGAGAGAAAGG - Intronic
1050552298 9:6758558-6758580 GTGGCGGACTCCAGGAAGGCCGG + Intronic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1055288810 9:74761009-74761031 GCTGGGAAGTCCAGGGTGGAGGG - Intronic
1055361288 9:75493402-75493424 GTGGGGAACTTCAGTGAGCCTGG + Intergenic
1055623618 9:78150462-78150484 GTGGGAAAGTCCAGGGCAGAGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057918747 9:99078872-99078894 GTGGGTACCTCCTGGGAGAAGGG + Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058939639 9:109801194-109801216 GTGGGTCCCTCCAGGGAGAAAGG + Intronic
1059404464 9:114091573-114091595 GTGGGAAATTAGAGGGAGGAAGG - Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1060640279 9:125232412-125232434 ATTGGGTAGTCCAGGGAGGAAGG - Intronic
1061975432 9:134066121-134066143 GTTGGGACATCCGGGGAGGAGGG - Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1062601157 9:137319143-137319165 GTGGGCAGCTCCAGGGCGGAGGG + Intronic
1203634001 Un_KI270750v1:94891-94913 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1186407712 X:9318208-9318230 TTGGTGACTTCCAGGGAGGATGG + Intergenic
1186645798 X:11506107-11506129 GTGGGAGACTTCAGGGAGGAGGG - Intronic
1189746830 X:44177166-44177188 GGGGGCAACACCAGGGTGGAAGG + Intronic
1190190693 X:48274548-48274570 GTGGGAAGCTGCAGGCAGGAAGG + Intronic
1190190699 X:48274588-48274610 GTGGGAAGCTGCAGGCAGGAAGG + Intronic
1190233789 X:48601133-48601155 GTGGTACACTCCAGGGAGCACGG + Intronic
1191136215 X:57067946-57067968 GTCATGAACTCCAGGGAAGAAGG + Intergenic
1192193777 X:69015357-69015379 CTGTGGAACACCAGGGAGAAGGG + Intergenic
1193317113 X:80077137-80077159 GTGGGGAATCACAGGGAAGAGGG + Intergenic
1194609481 X:96023486-96023508 CTGGTGAACTCCTGGGAGCAGGG + Intergenic
1196892865 X:120307876-120307898 GTGGGGCACTGCAGAGAGGGAGG - Intronic
1199309157 X:146302574-146302596 AGGGGGAATTCCAGGGAGAAAGG - Intergenic
1199677350 X:150199559-150199581 ATGGGTATCTCCAGGGAAGAAGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200110417 X:153738021-153738043 GAGGGGCATGCCAGGGAGGAGGG + Intronic
1201070543 Y:10143955-10143977 GTGAGGAAGTCCAAGGATGAGGG - Intergenic
1201766668 Y:17579447-17579469 GTGGGGAACTGCGGGCAGGTCGG - Intergenic
1201834884 Y:18326537-18326559 GTGGGGAACTGCGGGCAGGTCGG + Intergenic