ID: 1059437409

View in Genome Browser
Species Human (GRCh38)
Location 9:114284961-114284983
Sequence CACATTCAGCACTATGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059437402_1059437409 10 Left 1059437402 9:114284928-114284950 CCACTGTGCCCAGCCCGCAGGAG 0: 1
1: 2
2: 28
3: 302
4: 1857
Right 1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG 0: 1
1: 0
2: 5
3: 19
4: 162
1059437405_1059437409 -3 Left 1059437405 9:114284941-114284963 CCCGCAGGAGCTGTCAGATCCAC 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG 0: 1
1: 0
2: 5
3: 19
4: 162
1059437406_1059437409 -4 Left 1059437406 9:114284942-114284964 CCGCAGGAGCTGTCAGATCCACA 0: 1
1: 0
2: 1
3: 28
4: 197
Right 1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG 0: 1
1: 0
2: 5
3: 19
4: 162
1059437404_1059437409 1 Left 1059437404 9:114284937-114284959 CCAGCCCGCAGGAGCTGTCAGAT 0: 1
1: 0
2: 4
3: 10
4: 146
Right 1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG 0: 1
1: 0
2: 5
3: 19
4: 162
1059437400_1059437409 28 Left 1059437400 9:114284910-114284932 CCGAGGCTGGTGTCACTGCCACT 0: 1
1: 0
2: 4
3: 42
4: 370
Right 1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG 0: 1
1: 0
2: 5
3: 19
4: 162
1059437403_1059437409 2 Left 1059437403 9:114284936-114284958 CCCAGCCCGCAGGAGCTGTCAGA 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG 0: 1
1: 0
2: 5
3: 19
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059437409 Original CRISPR CACATTCAGCACTATGTGCT GGG Intronic
900813965 1:4829026-4829048 CACATTCAGGCCTCTGTGCTAGG - Intergenic
902895685 1:19478407-19478429 CACAATCATCACTACGTGCCAGG + Intronic
903462488 1:23529581-23529603 CACATTCAGCTCCAGGTCCTGGG - Intronic
904893674 1:33798408-33798430 CACCATCAGCACCATGTCCTGGG - Intronic
907381516 1:54094706-54094728 TTTATTCAGCACTATGTGCCAGG - Intronic
907888246 1:58613898-58613920 CACATTCAGCATTAAGCACTAGG + Intergenic
908897584 1:68917909-68917931 CACCTTCAAAACTATGTGCCTGG + Intergenic
910928468 1:92419806-92419828 CAAATTGAGCACTCTATGCTAGG + Intergenic
911355390 1:96811921-96811943 CACACACTGCACTATGTTCTGGG + Intronic
911358736 1:96851197-96851219 CATATTCAGCAATATGTATTGGG + Intergenic
911477339 1:98389708-98389730 CCCAGTCAGCACAATGTCCTAGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912618735 1:111133670-111133692 CACATCCAGCTCTATGACCTTGG - Intronic
913125470 1:115783437-115783459 CACATTCACTACTCTCTGCTGGG + Intergenic
917347783 1:174046445-174046467 CAAATTCTGCTCTATGTGCTGGG + Intergenic
917800624 1:178566324-178566346 CTCATACAGCTCTATGTGGTTGG + Intergenic
918065823 1:181101072-181101094 CACATGCAGCTCTATCTGCCTGG - Intergenic
919108724 1:193189894-193189916 TACATTCAACAATATGTCCTTGG + Intronic
920499556 1:206477668-206477690 CACACTCAGCACAAAGGGCTCGG - Intronic
920744453 1:208613439-208613461 CCCATGCAGCTCTATGGGCTTGG - Intergenic
922295445 1:224245963-224245985 CATATTCACAACTTTGTGCTTGG + Intronic
924540996 1:244980744-244980766 CATAGGCAGCACTGTGTGCTTGG + Intronic
1065300068 10:24312969-24312991 CTCATTGAGTCCTATGTGCTTGG - Intronic
1065334517 10:24642575-24642597 AGCATTCTGCACTATGTGATCGG + Intronic
1066364624 10:34764857-34764879 TACTTTGAGCACTGTGTGCTGGG - Intronic
1067750333 10:48967508-48967530 AATAATCACCACTATGTGCTGGG - Intronic
1068018826 10:51554711-51554733 TACATTCCTCACTGTGTGCTAGG + Intronic
1069537571 10:69266088-69266110 CACATTTAGCCCTATGTGGTAGG - Intronic
1071623893 10:87148252-87148274 AACATTCAACATTACGTGCTGGG - Intronic
1072324620 10:94285745-94285767 CACATTCTCCACTCTGAGCTGGG + Intronic
1072421404 10:95292676-95292698 TACATTAAGTACTATGTGCCAGG - Intergenic
1072530820 10:96317138-96317160 CACATTCAGCATTATATTATTGG - Intronic
1073068445 10:100778424-100778446 CATATCCAGCACTGTGAGCTAGG + Intronic
1074461542 10:113642643-113642665 AGCATTCATCACTATGAGCTGGG + Intronic
1075641404 10:124067091-124067113 CACATCCTGCACTTAGTGCTGGG + Intronic
1077252264 11:1565915-1565937 CAGGTCCAGCACCATGTGCTAGG - Exonic
1078375929 11:10792980-10793002 CACATTCAGAAATATGTCCAGGG + Intergenic
1079084291 11:17434081-17434103 CACATTTAGAACTATGTAGTTGG - Intronic
1079783632 11:24642272-24642294 CACATTCTGCATTTTGTCCTGGG + Intronic
1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG + Intronic
1081575532 11:44316647-44316669 CTCATTCAACACAATATGCTGGG - Intergenic
1082079674 11:48002509-48002531 CTTATTGAGCACTTTGTGCTAGG + Intronic
1082251910 11:49991970-49991992 CCTACTAAGCACTATGTGCTAGG + Intergenic
1082556423 11:54567986-54568008 CATACTAAGCACTATGTGCTAGG - Intergenic
1084092054 11:66885174-66885196 CACATTCTGACCTAGGTGCTAGG - Intronic
1085737188 11:79049131-79049153 CCCATTCAGCAATCTGTGCCAGG - Intronic
1088453473 11:110008132-110008154 CTCATGCAGCACTATGTGCTAGG + Intergenic
1090993411 11:131841369-131841391 AATGTTCAGCACTGTGTGCTAGG + Intronic
1094620701 12:32077798-32077820 CACAATCAGCCCAATGTGGTAGG + Intergenic
1096874311 12:54615355-54615377 CACATACAGCCCCATGAGCTGGG + Intergenic
1097104919 12:56616397-56616419 CAGATCCAGCACTTTGTGCTGGG + Intronic
1097707505 12:62883100-62883122 CAGATTCAGGGCTAGGTGCTGGG - Intronic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1098019880 12:66143269-66143291 CAAAATCAGCACTATGTCCATGG - Intronic
1098498869 12:71167074-71167096 TATAATCATCACTATGTGCTGGG + Intronic
1102909403 12:116701088-116701110 CCCACTCAGCTCTCTGTGCTGGG + Intergenic
1103369621 12:120408870-120408892 CACATACATCTCTACGTGCTTGG + Intergenic
1110849738 13:80231664-80231686 TTTATTGAGCACTATGTGCTAGG + Intergenic
1111914726 13:94349029-94349051 TCCATTCATCACTATGTGCCTGG - Intronic
1115015246 14:28603346-28603368 CACATTCAGTACTTTGTGCCTGG - Intergenic
1117197374 14:53353982-53354004 CACATGCAGGCCTAGGTGCTGGG + Intergenic
1117456871 14:55906514-55906536 CTCAGTCAGCACACTGTGCTGGG - Intergenic
1120638863 14:86985187-86985209 CACACTCAGAAATAGGTGCTGGG - Intergenic
1121250157 14:92493365-92493387 CACATTCTGCAGAATGTTCTAGG + Intronic
1121449911 14:94000692-94000714 CACAAGCAGCACTGGGTGCTGGG - Intergenic
1122105893 14:99454614-99454636 TACAATGAGCACTGTGTGCTAGG + Intronic
1124902572 15:33837940-33837962 CACATTAAACCCTATGTCCTTGG - Exonic
1126422991 15:48494979-48495001 CCCATTCAGCAATATGTTCGGGG + Intronic
1127392772 15:58520501-58520523 CACACTCACCTCTGTGTGCTGGG - Intronic
1128592286 15:68911044-68911066 CACATTCAGCAGTTTGTTCTAGG - Intronic
1136993596 16:35172717-35172739 CACACTCAGCACTGTGAACTGGG - Intergenic
1137865309 16:51889058-51889080 AACATTCAGTATGATGTGCTGGG - Intergenic
1140131118 16:72162647-72162669 TAAATTCTGCACTAAGTGCTAGG + Intronic
1140852693 16:78949556-78949578 GACATACAGCATTATGTGTTGGG - Intronic
1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG + Intronic
1141523392 16:84596338-84596360 GACATTCAGGACTCTGGGCTGGG - Intronic
1142620286 17:1161283-1161305 CACATTCTGCACTCTGGCCTGGG - Intronic
1143320531 17:6065797-6065819 CACATTCAGAACTTTATCCTTGG - Intronic
1144209483 17:13002543-13002565 CTCATTCAGGACCAAGTGCTGGG + Exonic
1144453156 17:15397830-15397852 CACATTCAGTTCTCTGTGGTTGG + Intergenic
1148735907 17:49864763-49864785 TTGATTCAGCACTATGTGCTGGG + Intergenic
1150767896 17:68016741-68016763 AACATTCAGCACTAAGTGCTCGG + Intergenic
1157993833 18:52530739-52530761 CATATTCAGAACACTGTGCTAGG + Intronic
1158246245 18:55435515-55435537 CATACTCAGCACTATGTGTCAGG - Intronic
1159154055 18:64558970-64558992 CACATTCAGCACTCAGCTCTTGG - Intergenic
1159740984 18:72170192-72170214 CATAGTCAGCACTCAGTGCTCGG - Intergenic
1160126341 18:76175904-76175926 CACATGCTGAGCTATGTGCTTGG - Intergenic
1163398839 19:17079592-17079614 AAAATTCAGCAGTATGTGCTTGG - Intronic
1165610173 19:37144530-37144552 CACAATCAGCACTGTGTACTGGG + Intronic
927831522 2:26355111-26355133 CTTATACAGCACTATGTGCCAGG - Intronic
928607684 2:32958780-32958802 CACAATCAGCAGTGTCTGCTGGG - Intronic
930597286 2:53403883-53403905 CAGATGCAGCACTAGCTGCTGGG - Intergenic
930741571 2:54837198-54837220 CACCTTCAGTACCATGTCCTGGG + Intronic
932099793 2:68888292-68888314 CAGGTTCTGCACTTTGTGCTGGG + Intergenic
932290316 2:70571482-70571504 CACCTTCTGGACTTTGTGCTAGG - Intergenic
932463234 2:71896905-71896927 CACATTCCTTACTATGTGCCAGG - Intergenic
932890135 2:75587446-75587468 CACATTCACTAATATGTTCTAGG - Intergenic
934512136 2:94953895-94953917 CACATTGAGGACAATGTCCTGGG - Intergenic
937533072 2:122853623-122853645 CACATCCATCTGTATGTGCTTGG + Intergenic
938602108 2:132852991-132853013 TTCATTGAGCACTATGTCCTTGG - Intronic
938976491 2:136483206-136483228 CACAGTAAGCACTCAGTGCTTGG - Intergenic
941788393 2:169523472-169523494 GGCATTCATCACTATCTGCTTGG + Intronic
942649613 2:178153371-178153393 AAGATACAGCACTCTGTGCTTGG - Intergenic
944889947 2:204107133-204107155 CACACTCAGCTCTATATGCGAGG + Intergenic
947842988 2:233220568-233220590 CACATTCCACAGGATGTGCTGGG - Intronic
1170561389 20:17561561-17561583 TTCATTCAGCACTATATCCTGGG - Intronic
1172190065 20:33056568-33056590 CCCATTCTGCAGAATGTGCTGGG + Exonic
1173154207 20:40594162-40594184 CAAATCCTGAACTATGTGCTGGG - Intergenic
1174111204 20:48199081-48199103 TAAATTCAGCAACATGTGCTGGG + Intergenic
1175554026 20:59835088-59835110 CATACTCAGCACTCTGTTCTGGG + Intronic
1177250797 21:18587875-18587897 CACATTGAGAACTATGTCTTGGG - Intergenic
1179319735 21:40278808-40278830 AACATTTATCACTATATGCTAGG - Intronic
1183294760 22:37022944-37022966 CACTTTAAGCCCTTTGTGCTGGG - Intronic
1184327699 22:43802738-43802760 CACATTCAGCTTTCTGTGCCCGG - Intronic
950132291 3:10555485-10555507 CACATTCATCTCTTTGTGCTGGG + Intronic
953823298 3:46228409-46228431 CAAATTCAGCACTAAGAGATAGG - Intronic
954791427 3:53136122-53136144 TCCATTCAGCACTCTGCGCTGGG + Intergenic
955106897 3:55907072-55907094 CTGATTCACCACTGTGTGCTAGG - Intronic
955161951 3:56472134-56472156 CAAAATCAGTACTATGTGCGAGG + Intergenic
955204675 3:56885116-56885138 CACAATCAGCAACACGTGCTGGG + Intronic
955204917 3:56887255-56887277 CACAATTAGCAACATGTGCTGGG + Intronic
957894506 3:86403851-86403873 CTTATTGAGCACTATGTACTAGG + Intergenic
961569094 3:127785403-127785425 CACATTCACCACTGGATGCTGGG + Intronic
962841746 3:139238789-139238811 CACACTCAGCGCTGGGTGCTGGG - Intronic
963949473 3:151182965-151182987 CACTTACACAACTATGTGCTAGG - Intronic
964489782 3:157223604-157223626 CAGCTTCAACACTCTGTGCTGGG + Intergenic
966165833 3:177015349-177015371 CACATGCATTGCTATGTGCTGGG + Intergenic
967191211 3:186986339-186986361 AATATTCAACACTATGTGCCAGG - Intronic
967529380 3:190531553-190531575 AACATTCAGGAGTATGTGCCGGG - Intronic
968861959 4:3179374-3179396 CACACCCAGTACTTTGTGCTGGG + Intronic
970542319 4:17092546-17092568 TTCAATCAGCACTATGTGCTGGG + Intergenic
971382818 4:26115060-26115082 CACATTCAGTACTATTTTGTTGG + Intergenic
976590164 4:86841962-86841984 TTTATTGAGCACTATGTGCTAGG + Intronic
977880596 4:102200040-102200062 CACAATGGGCACTATGTGGTTGG - Intergenic
981737652 4:147969933-147969955 CAGATTCTTCACTGTGTGCTTGG + Intronic
984780393 4:183520422-183520444 CATATCCAGCACTATGGTCTTGG + Intergenic
986295132 5:6431339-6431361 CTCATCCAGCACAAGGTGCTGGG - Intergenic
987048093 5:14126152-14126174 CTCATTGAGCCCTATGTGCTAGG - Intergenic
988281611 5:29155761-29155783 CATATTCAGTACAATGTCCTAGG - Intergenic
988398216 5:30725072-30725094 TACATTCTGCATTCTGTGCTGGG + Intergenic
990434170 5:55770965-55770987 CATTTGCAGCTCTATGTGCTTGG + Intronic
994796427 5:104306595-104306617 AACCTTCAGCACAATGTGGTAGG + Intergenic
995273475 5:110250216-110250238 GACATTCAAAACAATGTGCTTGG + Intergenic
997757025 5:136408977-136408999 CAAATGCACCACTCTGTGCTGGG - Intergenic
1000870660 5:166573231-166573253 CACACTCAGCATTCTGTGCCTGG - Intergenic
1004122355 6:12836647-12836669 CACATTCAGCATTAATTGCTAGG + Intronic
1005889005 6:30121039-30121061 CACATTAAGAACTTTGTGCCGGG - Intergenic
1013400288 6:109788350-109788372 CAGCTTCAGCACTATGTGTGGGG + Intronic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG + Intergenic
1018035904 6:159880809-159880831 CACATTCCACACCATCTGCTGGG - Intergenic
1018112440 6:160548426-160548448 CACATACCTCTCTATGTGCTTGG - Intronic
1019710998 7:2518292-2518314 CACAGCCAGCACCATCTGCTGGG + Intronic
1020471184 7:8536995-8537017 CACATACAGCTCTATGTTCTGGG + Intronic
1021091814 7:16492553-16492575 CACATTCAGCACAATCTGGTTGG - Intronic
1021691272 7:23233020-23233042 CACAGTCATCATTATGTCCTGGG + Intergenic
1021986377 7:26101865-26101887 CACGTGCAGGACTCTGTGCTGGG - Intergenic
1024019884 7:45359089-45359111 CACATTCAGCATTCCATGCTGGG - Intergenic
1024446521 7:49485645-49485667 CACAATAAACACTATGTGCCAGG - Intergenic
1029352304 7:100022823-100022845 AACATTCAGCTCTCTGGGCTGGG + Intronic
1030956610 7:115860707-115860729 CACATCTAACACTATGTGCCAGG + Intergenic
1032646649 7:133832267-133832289 CACATTCTGCACTAAATCCTAGG + Intronic
1034111152 7:148538786-148538808 CACTTTCAGCACTGTGTGGATGG - Intergenic
1035915920 8:3622083-3622105 CACAGTCTGCACTATGTGCTGGG + Intronic
1039750076 8:40470494-40470516 CACATTCTGTACTGTGGGCTAGG - Intergenic
1041551384 8:59105448-59105470 AAAATTCAGCTCTATGTGCGGGG - Intronic
1042804136 8:72753877-72753899 CACATTAAGCAATATGTTCTTGG + Intronic
1044993628 8:97818332-97818354 ACCATTCAACACTATGTGTTTGG - Intronic
1048295186 8:133208838-133208860 CAGGTGCAGCACTAGGTGCTGGG - Intronic
1053874514 9:42529663-42529685 GACATTTTGCACCATGTGCTTGG - Intergenic
1058545455 9:106056323-106056345 GTCTTTCAGCACTTTGTGCTAGG + Intergenic
1059397746 9:114049025-114049047 CACATCAAGAGCTATGTGCTTGG + Exonic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1060216788 9:121743241-121743263 CTCTTTGGGCACTATGTGCTGGG - Intronic
1061560920 9:131402597-131402619 CCCATTCATCACTGTGTGCCAGG + Intronic
1061581252 9:131538143-131538165 CACATTTTGCACTCTTTGCTTGG - Intergenic
1185892532 X:3834204-3834226 CACATACAGCAGGGTGTGCTGGG + Intronic
1185897640 X:3872624-3872646 CACATACAGCAGGGTGTGCTGGG + Intergenic
1185902759 X:3911055-3911077 CACATACAGCAGGGTGTGCTGGG + Intergenic
1186394868 X:9197782-9197804 CACATGCATCACTATTTGTTTGG + Intergenic
1188220184 X:27531824-27531846 TACATTCAGGGATATGTGCTAGG + Intergenic
1189314436 X:40044247-40044269 CACATCTAGCACTAAGTTCTTGG - Intergenic
1190413388 X:50158772-50158794 CACCATCAGCACTTTGTGGTTGG - Intergenic
1190453629 X:50604715-50604737 CACATTAGGCACTATATTCTAGG + Intronic
1194751293 X:97687239-97687261 CACATTCAGGACTCTGTATTTGG + Intergenic
1199860909 X:151799913-151799935 CATATTCTGGACTCTGTGCTGGG - Intergenic
1201616678 Y:15908290-15908312 AATATTCAACACTATGGGCTTGG - Intergenic