ID: 1059438076

View in Genome Browser
Species Human (GRCh38)
Location 9:114288443-114288465
Sequence CTGTGTCCACAGGGGGAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 302}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059438069_1059438076 -9 Left 1059438069 9:114288429-114288451 CCCTAAAGCTGGTTCTGTGTCCA 0: 1
1: 0
2: 2
3: 19
4: 174
Right 1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG 0: 1
1: 0
2: 1
3: 34
4: 302
1059438062_1059438076 19 Left 1059438062 9:114288401-114288423 CCCACATTCCCCAGGAGCAGGCG 0: 1
1: 0
2: 1
3: 10
4: 177
Right 1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG 0: 1
1: 0
2: 1
3: 34
4: 302
1059438067_1059438076 9 Left 1059438067 9:114288411-114288433 CCAGGAGCAGGCGGTTTGCCCTA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG 0: 1
1: 0
2: 1
3: 34
4: 302
1059438061_1059438076 20 Left 1059438061 9:114288400-114288422 CCCCACATTCCCCAGGAGCAGGC 0: 1
1: 0
2: 1
3: 42
4: 368
Right 1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG 0: 1
1: 0
2: 1
3: 34
4: 302
1059438066_1059438076 10 Left 1059438066 9:114288410-114288432 CCCAGGAGCAGGCGGTTTGCCCT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG 0: 1
1: 0
2: 1
3: 34
4: 302
1059438070_1059438076 -10 Left 1059438070 9:114288430-114288452 CCTAAAGCTGGTTCTGTGTCCAC 0: 1
1: 0
2: 7
3: 12
4: 184
Right 1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG 0: 1
1: 0
2: 1
3: 34
4: 302
1059438063_1059438076 18 Left 1059438063 9:114288402-114288424 CCACATTCCCCAGGAGCAGGCGG 0: 1
1: 0
2: 2
3: 22
4: 268
Right 1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG 0: 1
1: 0
2: 1
3: 34
4: 302
1059438065_1059438076 11 Left 1059438065 9:114288409-114288431 CCCCAGGAGCAGGCGGTTTGCCC 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG 0: 1
1: 0
2: 1
3: 34
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059438076 Original CRISPR CTGTGTCCACAGGGGGAGCA GGG Exonic
901673419 1:10868898-10868920 CTGTGTCCCAGGGGGGTGCATGG + Intergenic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
905441944 1:38001332-38001354 ATGCGTCCACAGGGGGTGCCTGG + Intronic
907888073 1:58612289-58612311 CTGGATCCACAAGGGGATCATGG - Intergenic
908645755 1:66275945-66275967 CTGTGTCCACAGAGTAAGCTGGG + Intronic
910366494 1:86470853-86470875 CTGTCCCCACAGGGGCACCAGGG - Intronic
913050018 1:115109460-115109482 CTGTGTCCAAATGTGGAGGAAGG + Intergenic
915318205 1:155041554-155041576 CTGTGTCGACAGGTGGAGTCTGG - Exonic
915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG + Intronic
915973129 1:160367703-160367725 CTGGGGCCAGATGGGGAGCACGG + Intronic
916564140 1:165958600-165958622 CTCTGCCCACAGTGGGAGGAGGG - Intergenic
917670745 1:177270996-177271018 CTGTGTCCACATGTGGAGGGAGG + Intronic
918145964 1:181756066-181756088 CCGTCTCCACAGGGGAAGGATGG + Exonic
920178709 1:204119407-204119429 CTGTGTCCTCAGGTGGTGAAAGG + Intronic
920347557 1:205316461-205316483 CTTTGCCCATAGGAGGAGCAGGG + Intronic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
921710938 1:218372389-218372411 ATGTGTTCACAGTGGCAGCAGGG + Intronic
922042197 1:221907457-221907479 CTTAGTGCACAGGGAGAGCAAGG + Intergenic
922515378 1:226204109-226204131 CTGTGTCATGAGGGAGAGCATGG - Intergenic
922721065 1:227900560-227900582 CTATGTCTACAGGGGGACCTGGG + Intergenic
922721100 1:227900684-227900706 CCATGTCCACAGGGGGACCTGGG + Intergenic
923101697 1:230822427-230822449 CTCTGTCCACAGGAAGAGCTGGG + Intergenic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063142606 10:3268657-3268679 CTGTGTCCACAGGGTGGAAAGGG + Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063539126 10:6914349-6914371 CTGTGTCCACTGGAGGAGCTCGG - Intergenic
1066663387 10:37758483-37758505 CTCTGTCCACTGAGGGGGCATGG - Intergenic
1067095020 10:43294538-43294560 GTGTGTCCACAGGAGGAGCTGGG - Intergenic
1067411646 10:46069800-46069822 CTCCATCCAGAGGGGGAGCAGGG - Intergenic
1067711611 10:48655432-48655454 CAGTGACCTCAGGGGGAGAAGGG + Intronic
1067931616 10:50567796-50567818 CTTTTTCCACAGGGGGAAAAGGG + Intronic
1069637246 10:69932548-69932570 TTGTGCCCACAGGGAGAGAAAGG + Exonic
1069979917 10:72245266-72245288 CTGTGGCCACAGAGTCAGCAGGG - Intergenic
1070630566 10:78081777-78081799 CTGTGTAGAGAGCGGGAGCAAGG + Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1070786045 10:79162803-79162825 GTGGGTCCTCAGGGGGAGCAGGG - Intronic
1075406775 10:122200558-122200580 CTGCGTTCACATGGGGAGGACGG + Intronic
1075406816 10:122200738-122200760 CCGTGTTCACATGGGGAGGACGG + Intronic
1075406973 10:122201503-122201525 CTGTGTTCATATGGGGAGGACGG + Intronic
1075423553 10:122324416-122324438 CTGTGTCCCCAGGGTGGGCGAGG + Intronic
1076520327 10:131077126-131077148 AGGTGCCCACAGGGTGAGCAAGG + Intergenic
1076737742 10:132466259-132466281 CTGTGGCCACAGGAGGGGCCCGG - Intergenic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077548902 11:3190727-3190749 CTGTGTCCTCACGGGGTGGAAGG + Intergenic
1079467464 11:20744787-20744809 TTCTGTCCACAGTGGGAGTAGGG + Intronic
1080386551 11:31814136-31814158 CTCTGGCCACAGGGGGCGGAGGG - Intronic
1081889532 11:46529298-46529320 CTGTTTCCAAAGGGGGAAAATGG - Intronic
1082069042 11:47923864-47923886 CAGTGTCCACAGAGAGAGCAGGG - Intergenic
1082626302 11:55491067-55491089 CTGTGTCGCCAGGGGAAACATGG + Intergenic
1083709474 11:64539232-64539254 CTGAGGCGACAGGAGGAGCAGGG + Intergenic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1086103928 11:83129175-83129197 CTGTGTCCACAGGGGCTGACAGG - Intergenic
1088119496 11:106351429-106351451 CTGTGTCCTCAGAGGTAGAAAGG + Intergenic
1089900737 11:121981024-121981046 CTGTGTACACAAGGGGATCTTGG + Intergenic
1090479855 11:127058629-127058651 ATGTGGCCAAAGAGGGAGCAGGG - Intergenic
1091194193 11:133717938-133717960 CTGTGTCCTCAGAGGTAGAAGGG + Intergenic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092779612 12:11973284-11973306 CTGTGTCTTCAGGGGGTTCACGG + Intergenic
1093873809 12:24325620-24325642 CTGTGTCTACAGAGGAAGAAGGG + Intergenic
1096215638 12:49796307-49796329 CTGTCCCCAGAGGGGGCGCAAGG - Exonic
1096237833 12:49942098-49942120 CTGTCCCCACAGTGGGAGCAAGG - Intergenic
1096283481 12:50277334-50277356 CAGTGTCCACCGGAGTAGCAAGG - Intronic
1096883077 12:54688344-54688366 CAGTGTCCAGTGAGGGAGCAAGG + Intergenic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1098114058 12:67155817-67155839 ATATGTCCAAAGGGGAAGCAGGG + Intergenic
1098498351 12:71163012-71163034 ATGTGGCCACAGAGGGGGCAGGG - Intronic
1100524703 12:95408413-95408435 CTGTGCTCACAGGAGCAGCATGG + Intergenic
1101788926 12:107911009-107911031 CTGTGCCCACATGGGAAGTACGG + Intergenic
1102005324 12:109586010-109586032 CTGTGTCTTCAGGTGGACCAAGG + Exonic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1102851918 12:116254749-116254771 CTGTGTCCAAAGGGGGTGGGGGG + Intronic
1103061856 12:117864638-117864660 CAGTGCCTTCAGGGGGAGCATGG - Intronic
1103407829 12:120687871-120687893 CTGTCTCGACAGGAGAAGCAGGG - Intronic
1104802786 12:131565985-131566007 CTCAGCCCACAGGGAGAGCAGGG - Intergenic
1104842818 12:131832716-131832738 CAGGGTCCACAGGGGAAGCCAGG - Intronic
1105050828 12:133049246-133049268 CTTTGACCACAGGGGAAGGAGGG - Intronic
1107934349 13:45332449-45332471 CTGAGTCCAGAGGTAGAGCAAGG - Intergenic
1109191534 13:59329698-59329720 CTGTGTCCTCAAGTGGTGCAGGG + Intergenic
1109649707 13:65310047-65310069 GGGTGTCATCAGGGGGAGCATGG - Intergenic
1110500844 13:76226112-76226134 GTGTGTGCACAGTGGGAACAAGG - Intergenic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1112839409 13:103558025-103558047 CTGTCACCATAGTGGGAGCATGG + Intergenic
1112842890 13:103601389-103601411 CTGAGTCCACAGTGGCAGCCCGG + Intergenic
1113426396 13:110211912-110211934 CTGTCTCCCCAGGGGGAGAGAGG - Exonic
1113598277 13:111549402-111549424 CTGTCTCCACAGGGTGATCCTGG - Intergenic
1113788212 13:113014095-113014117 CTGGGAGCACGGGGGGAGCATGG - Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1116250685 14:42479219-42479241 CTGTGTCCACACGTGGTGGAAGG - Intergenic
1117997327 14:61490026-61490048 CTGTGTGCCCAGGGGTAACATGG - Intronic
1118305432 14:64651186-64651208 ATGTGTCCACAGGTTGGGCAGGG - Intergenic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1119323325 14:73744290-73744312 CTGTGGCCACTGTGGGACCAGGG + Intronic
1119617353 14:76107601-76107623 CTTTGTCTACAAAGGGAGCAGGG - Intergenic
1121318248 14:92974875-92974897 CTGTGGTCACAGGAGGAGCGGGG + Intronic
1121781153 14:96623485-96623507 ATCTCTCCAAAGGGGGAGCAGGG - Intergenic
1122117772 14:99536237-99536259 CTGTTTCCACAGGGCGGGCGAGG - Intronic
1122235301 14:100327813-100327835 CTGTCTCCCCTGCGGGAGCAAGG - Intronic
1123017503 14:105382372-105382394 CTGTGGCTGCAGGGGGAGCAGGG + Intronic
1123121137 14:105917689-105917711 CTGGGTCCAAGAGGGGAGCAGGG + Intergenic
1123700044 15:22907596-22907618 CCGTTTCCACTGTGGGAGCAGGG - Intronic
1124387679 15:29223940-29223962 CTGTGTTCACAGGCAGAGCTGGG - Intronic
1125130411 15:36278470-36278492 CTCTTCCCACAGAGGGAGCAGGG - Intergenic
1126333059 15:47554842-47554864 CTGTGTTCTCAGGGGGATTATGG + Intronic
1127825868 15:62702245-62702267 CTGCATCCACTGGGGGACCATGG + Intronic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1128601246 15:68997237-68997259 CTGGCTCCACAGGAGAAGCATGG - Intronic
1129243986 15:74268815-74268837 CTGTGGGCTCAGGGGGAGCACGG - Intronic
1130520309 15:84656840-84656862 CTGTGTAGACTGGGGGAGAAAGG + Intronic
1130675742 15:85950407-85950429 CTGGGTTCACATGGAGAGCATGG + Intergenic
1131406803 15:92171763-92171785 CTGTGCCTAAAGGGGGAGGAGGG - Intronic
1132558545 16:583339-583361 CTGGGTACACAGGGTGGGCATGG - Exonic
1134156126 16:11844693-11844715 CTGTGTCCACTGGGTCTGCACGG + Intronic
1135399952 16:22159843-22159865 CAGTGTCTTCAGAGGGAGCATGG - Intergenic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1136519303 16:30786053-30786075 CTGTGTGCACAGGGGCAGTGGGG + Intronic
1137396962 16:48123020-48123042 CTGTGGTCACTGGGGAAGCAGGG - Intronic
1138350807 16:56345360-56345382 CAGTGTCCAGAGTGGGGGCAGGG - Exonic
1140131311 16:72164344-72164366 CAGTGTCCATTGGGGTAGCAGGG - Intronic
1140439771 16:74978614-74978636 TTGAGTACACAGGGGGACCAAGG + Intronic
1141432198 16:83976066-83976088 CTGTGTGCAGAGGGGGCCCAAGG + Intronic
1141466906 16:84212271-84212293 CTGTGTCAACAGGGCGAGGAAGG - Intergenic
1142153566 16:88523247-88523269 CAGTGCCCACAGGCAGAGCAGGG + Intronic
1142433049 16:90040804-90040826 CTGAGTCCACAGGTGGGGCTGGG + Intronic
1143189951 17:5033799-5033821 CTGTAACCACAGGGGGCTCAGGG - Exonic
1143834850 17:9682887-9682909 CTCTCTCCACAGTGAGAGCAAGG + Exonic
1144201630 17:12947365-12947387 CTCTGACCACAGGGGCATCAGGG + Intronic
1145898360 17:28473946-28473968 CTCAGTCCTCAGGAGGAGCAGGG - Intronic
1146286083 17:31575033-31575055 CTGTGTTCACAGGAGGGGCGTGG - Intronic
1147342915 17:39765646-39765668 CTGTGTTCACAGGGGTAGCCAGG - Exonic
1147653967 17:42078022-42078044 CGGTTTCCACTGGGGGAGCCTGG - Intergenic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148127084 17:45242479-45242501 CGGTGCCCACATGGGGAGCCAGG - Intronic
1148237071 17:45976128-45976150 CTGTGCCCACATGGGGCCCACGG + Intronic
1148795084 17:50193037-50193059 CTTTCTCCACAGGGAGAGCCCGG - Exonic
1149707466 17:58707880-58707902 CTGTGTCCTCATGGGGAGGAAGG + Intronic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1152067404 17:78119202-78119224 CTGTGGCCCCAGGGGGAGGCAGG + Intronic
1152260652 17:79265089-79265111 CAGTGACCACAGGGTGAGCTGGG + Intronic
1152333063 17:79684804-79684826 CTGGGCCCACTGGGGCAGCAGGG - Intergenic
1152812498 17:82388693-82388715 GTGAGGCCACAGGGTGAGCAAGG - Intergenic
1155072796 18:22330917-22330939 CTGTCTCCACAAAGAGAGCAAGG + Intergenic
1156371053 18:36471434-36471456 CTGTGGACACAGGGTGACCAAGG - Intronic
1156480350 18:37432341-37432363 CTGGGCCCAGAGGGGGAGCTTGG + Intronic
1157327317 18:46678539-46678561 CTGTGTCTTCTGGGGGTGCAGGG - Intronic
1160031940 18:75269556-75269578 CTGACTCCACAGAGGGAGCCTGG + Intronic
1160305718 18:77733843-77733865 CTGTGTCCTGAGGGCCAGCATGG - Intergenic
1160766493 19:810986-811008 CTGTCACCGCAGGGTGAGCAAGG - Exonic
1160802388 19:976435-976457 CTGTGCCCCCAGGGGGACCCTGG + Intergenic
1161325553 19:3662049-3662071 CGGTGCACACAGGGGGTGCAGGG - Intronic
1161592007 19:5133131-5133153 CTGTGTCCACAGGAGATGCAGGG + Intronic
1161772584 19:6239125-6239147 CTGTGTCCAGAGGAGGGGCAGGG - Intronic
1161914425 19:7218012-7218034 CTGTCTCCACTGTGGGAGGATGG + Intronic
1162111648 19:8403054-8403076 CTGTGTCCCCAGTGCCAGCAAGG - Intronic
1162476688 19:10904715-10904737 CTGTGTCCTCAGGATGATCAGGG - Intronic
1164712795 19:30369957-30369979 TTGTGTCCACAGTGGGGGGATGG + Intronic
1165901800 19:39172736-39172758 CTGTGTCCCCAGGGAGGGGAGGG + Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1167240233 19:48339084-48339106 CTGTGCCCAGAGGAGGGGCAGGG + Intronic
1167665009 19:50818725-50818747 CTGTGTCCACCTGGGGACAAGGG - Intergenic
1167775311 19:51550786-51550808 TTGTGGCCACAGGGGGATTATGG + Intergenic
1168682226 19:58324333-58324355 CAGTGTCCAAGGGGTGAGCAAGG - Intergenic
925913360 2:8587484-8587506 CTGTGGCCACCGCGGCAGCACGG + Intergenic
926107196 2:10159917-10159939 CTGTGTCCTCAAGGAGAGCCGGG - Intronic
927081285 2:19633351-19633373 CTGCGTCCATGGGGGGAGCTTGG - Intergenic
927862000 2:26565887-26565909 CTGTGTCCCCAGGAACAGCATGG - Intronic
927902270 2:26829096-26829118 CTGTCTCCACAGGAGCAGCGGGG + Intergenic
928268915 2:29837019-29837041 CTGTGTTCACAGTGGGATCAGGG - Intronic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
929688154 2:44052237-44052259 ATGGGGCCACAGGGGGAACAGGG + Intergenic
929968256 2:46551522-46551544 CAGTGTCAACATGTGGAGCAGGG + Intronic
930752389 2:54945924-54945946 CTGTTTCCACAGGGGGTACAGGG + Intronic
932416911 2:71579092-71579114 CTGTGGCCACAGGGGGTGTGGGG - Intronic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
932762162 2:74445356-74445378 TTGTGTTCACTGGGGGAGCAGGG - Intergenic
933874305 2:86602845-86602867 CTGGGTTCACAGGAGTAGCAGGG - Intronic
935792127 2:106602161-106602183 CAGTGTCCTGAGGGTGAGCAGGG + Intergenic
936310187 2:111377233-111377255 CTGTCTCCACCTGCGGAGCAGGG - Intergenic
937253355 2:120538117-120538139 CTGTGCCCAGAGGAGGAACAGGG + Intergenic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
938444393 2:131366434-131366456 TTGGGTCCCCTGGGGGAGCAGGG - Intergenic
940378569 2:152986963-152986985 CTGTGTCCAAAGGTGGTGGAGGG - Intergenic
945044617 2:205770865-205770887 CTGTGTCCCCTGGGGAAGGATGG - Intronic
946991073 2:225330292-225330314 CTGACTCCAGAGAGGGAGCATGG + Intergenic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
948571445 2:238920295-238920317 CTGAGGCCACTGTGGGAGCATGG - Intergenic
948932445 2:241140661-241140683 CCGTGTGCTCAGGGGCAGCAGGG + Exonic
948946662 2:241223985-241224007 CTGTGACCTCAGGGAGTGCACGG - Intronic
1173860039 20:46277372-46277394 CTGTGTCCACAGAGAGGACAAGG - Intronic
1174085589 20:48005421-48005443 CTGTGTCCAAATGGGTAGAAGGG + Intergenic
1174220863 20:48954111-48954133 CAGTGTCCACAGGAGGACAAGGG + Intronic
1176092447 20:63325257-63325279 CTGTGTCTCCAGGGAGAGCCCGG + Intronic
1176272814 20:64245271-64245293 CTGTGTCCACATGCTGGGCAGGG - Intergenic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1180084962 21:45504404-45504426 TTCCGTCCACAGGGGGAGAAGGG + Exonic
1180162644 21:46005247-46005269 CTCTGTCCACAGGTGCAGCATGG - Intergenic
1180226053 21:46393158-46393180 GTGTGTCCACAGGGGGAGTGCGG + Intronic
1180971059 22:19815974-19815996 CTGTGTGCACAGGGCTAGGAGGG - Intronic
1181458858 22:23074518-23074540 ATGTGGCCAGAGGGAGAGCAAGG + Intronic
1181809217 22:25393196-25393218 CTATGTCCACAGGGGAGGCTTGG - Intronic
1182146165 22:27998119-27998141 CTGTGTTCTCAGGGGTAACAAGG - Intronic
1182351257 22:29701221-29701243 CTGTCTTCACAGGGGGTGGAAGG - Intergenic
1182497303 22:30718646-30718668 CTGTGGCCCCAGGGGCAGGAAGG - Intronic
1183043272 22:35199535-35199557 CTGTGGCAACAGGGAGAGAAAGG - Intergenic
1183554306 22:38513253-38513275 CAGTGACAGCAGGGGGAGCAGGG - Intergenic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1185096495 22:48808821-48808843 CTCTGCCCAGAGGGGGACCAGGG - Intronic
950634794 3:14307300-14307322 CTGAGACCTCAGTGGGAGCAGGG + Intergenic
951389075 3:22080835-22080857 CTGTGTCCTCACGTGGAGCAAGG - Intronic
952163821 3:30723949-30723971 CTAGGGCCATAGGGGGAGCATGG + Intergenic
954135959 3:48582348-48582370 CTCTCTCCACAGGGGGAGCCTGG - Exonic
954412569 3:50377417-50377439 CTGTGTCCACATGGGAGGCAGGG + Intronic
954975728 3:54692429-54692451 CTGTGCCTGCAGAGGGAGCAGGG + Intronic
955393069 3:58535291-58535313 CAGTGTCCACAGGGGGAGTGGGG - Intronic
955418411 3:58714190-58714212 CTGAGTCAACAGGCGGAGAAGGG - Intergenic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
958145599 3:89620583-89620605 CTGTATTCACAGGTGTAGCAAGG - Intergenic
960629053 3:119710377-119710399 CTGTGTCCTCACGTGGAGGAAGG + Intronic
960876302 3:122298401-122298423 ATGTGTCCACTGGGGGAGGCAGG + Intergenic
961190068 3:124952658-124952680 ATGTGTTCACAGGGGGAGTAGGG + Intronic
961454631 3:127017929-127017951 CAGGGTCCACAGGTGGGGCATGG - Intronic
961710445 3:128824159-128824181 CTGTGTCTACATGGGGTGCTGGG + Intergenic
961815439 3:129547786-129547808 CTGAGACCACAGGAGGAACAAGG - Intronic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
966854331 3:184183906-184183928 CTGTGGCCACAGGGGTGGGAAGG - Exonic
968524515 4:1049199-1049221 CTGTGGCCACAGGGGAGGCCGGG - Intergenic
968622903 4:1611689-1611711 CTCTGTCCACACGGTGGGCAAGG + Intergenic
968960274 4:3739859-3739881 CTGTGGTTTCAGGGGGAGCATGG - Intergenic
969128456 4:4972208-4972230 CTGTGTCCACACAGGGTGGAAGG - Intergenic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
970453273 4:16193711-16193733 CTGTCTCCACTTGGGCAGCAGGG + Intronic
970542738 4:17095911-17095933 CTTACTCCACAGGGGGAGCCTGG - Intergenic
974144810 4:57934076-57934098 ATTTGTCCCCAGGTGGAGCAAGG - Intergenic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
978449814 4:108819888-108819910 TTGTATCCACAGGGGGAAAAGGG - Intronic
978827973 4:113047616-113047638 CTGTGACCACAGTGGGAGTTGGG + Intronic
981563268 4:146070193-146070215 CTGTGTCCTCAGTGGGGGAAGGG - Intergenic
982257510 4:153465664-153465686 CAGTGTCCACAGAGGGTGCCGGG + Intergenic
982790587 4:159586950-159586972 CTGTGTCCTGAGGGTGCGCAGGG + Intergenic
983999136 4:174218654-174218676 CGGTGGCCACAGGGGTAGCTGGG + Intergenic
985668787 5:1195874-1195896 CTGTGTCCCCAGGGGGTGGGAGG - Intergenic
985701838 5:1378167-1378189 CTGTGTCCACTGGGGGACCTCGG - Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
986916321 5:12625023-12625045 CAGTGTCCCCAGGGTGTGCAGGG - Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987085745 5:14465937-14465959 CTGACTCCACTGGGAGAGCATGG - Intronic
987087896 5:14487203-14487225 CAGTGTCCACAGGAAGACCAAGG - Intronic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
992387112 5:76295278-76295300 CTGTGTCCTCAGTGGTAGAAGGG + Intronic
994236163 5:97365551-97365573 CTGTGTTCAGAGTGGGAACAGGG + Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
996165872 5:120222363-120222385 TTGTGTCCACAGAGGGATTATGG + Intergenic
996889686 5:128403449-128403471 TTGTGTACACAGGGTGAGAAAGG - Intronic
997376831 5:133403472-133403494 CTGGGGCCACACGAGGAGCAAGG - Intronic
997379546 5:133425884-133425906 CTGGGTCCAAAGGGAGAACAGGG + Intronic
998761856 5:145440878-145440900 TTGTGACCACAGGAGGAACATGG - Intergenic
1000977180 5:167778011-167778033 CTCTGTCCACTGTGGCAGCAAGG - Intronic
1001566591 5:172703485-172703507 CTGAGTCCACACGTGGTGCAAGG + Intergenic
1002067972 5:176661852-176661874 CTGTGTCCCCACTGGCAGCAGGG - Intergenic
1002300791 5:178256387-178256409 ATGTCTCCACAGGGGGAGCCTGG - Exonic
1005452974 6:25992050-25992072 CGGTGTCCCCAGCTGGAGCAGGG + Intergenic
1006296521 6:33172351-33172373 CTGGGGCCCCAGGGGGACCAGGG + Exonic
1006510416 6:34518304-34518326 CTGTGGCCACCTGGAGAGCAGGG - Intronic
1006642251 6:35495549-35495571 CTCTGCCCACTGGGTGAGCAGGG + Intronic
1008581190 6:52908884-52908906 CTGGGACCAAAGGGTGAGCAGGG - Intronic
1010060813 6:71620681-71620703 CTTGGTCTACAGGGAGAGCAGGG - Intergenic
1010524503 6:76884203-76884225 CAGAGTCCACATGGGGAGGATGG + Intergenic
1010972268 6:82275561-82275583 CTCTGTCCAGAGTGGGAGGAGGG - Intergenic
1011809194 6:91110611-91110633 CTGTGTTAACAGGTAGAGCATGG - Intergenic
1013089211 6:106884255-106884277 CTGTTTCCACAGGGTAACCAGGG - Intergenic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1018908061 6:168086650-168086672 CCATGTCCACAGTGGGAACATGG - Intergenic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1018940907 6:168308445-168308467 CTGTGTCCTCAGGGAGACCATGG - Exonic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019625689 7:2014632-2014654 CTGTGTCCACAGGAGCGGGACGG - Exonic
1019928107 7:4206393-4206415 CTGTGACCAAGGGGGGAGCTGGG - Intronic
1020259979 7:6525896-6525918 CTGTGTCCACAGGGAGGGCCGGG - Intronic
1026662895 7:72317584-72317606 CTGTGACCACAGGGCGAACTGGG + Intronic
1027124282 7:75544919-75544941 CTGTGTCCCCTGGGAGAGCCAGG + Intronic
1029127400 7:98304084-98304106 CTCTGTCCCCAGGGGGAGAGTGG - Intronic
1033060058 7:138097526-138097548 CTGTCCCAGCAGGGGGAGCAGGG + Intronic
1034769935 7:153764341-153764363 CTGAGTGCAGAGGAGGAGCAAGG - Intergenic
1035635263 8:1139463-1139485 ATGTGTCCTCACGTGGAGCAAGG + Intergenic
1036068696 8:5415228-5415250 CTGTGAGCACAGGAGGAGCTGGG + Intergenic
1036185855 8:6621974-6621996 CTGTGCCCACAGGGGTGGCCCGG - Intronic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036443470 8:8801793-8801815 CAGTGTCCACAGGGGAGGCCAGG + Intronic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1037320112 8:17633702-17633724 TGGTGTCCACAGGGGTGGCAGGG - Intronic
1039395548 8:37222388-37222410 CTGGGCCCACAGGGGGAACAAGG - Intergenic
1040075034 8:43220549-43220571 CTGTTTCCACAGAGTGGGCAGGG - Intergenic
1040547094 8:48407204-48407226 CAGTGTCCACACTGGGAGTAGGG - Intergenic
1040598430 8:48861928-48861950 CGGTGGCCACAGGGCGAGCATGG + Intergenic
1041178690 8:55225536-55225558 CTGTCTCCATAGGAGGAGAATGG - Intronic
1043763867 8:84104570-84104592 GTCTGTCCACAGGGGGAAAAAGG + Intergenic
1045375082 8:101564431-101564453 ATGTGTGCACAGTGGTAGCAGGG + Intronic
1047483579 8:125308008-125308030 CTGTTTCCACAGGGGAAGCAGGG - Intronic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1047953308 8:129953615-129953637 CTGTATCCCCAGTGAGAGCACGG + Intronic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048876813 8:138843134-138843156 CTATGTGCACAGTGGGAGAAAGG - Intronic
1048996030 8:139794197-139794219 CTGGGACCACAGTGGGAGCCAGG - Intronic
1049339819 8:142106064-142106086 CTCTGTCCACAGGAAGAGCCCGG - Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049707048 8:144047823-144047845 CTGTGGCCACAGGGTGAGACAGG + Intergenic
1051551001 9:18329161-18329183 CTGTGTCCTCACGGGTAGAAGGG - Intergenic
1051929365 9:22366806-22366828 CTTTCTCCACAGGGGTACCATGG + Intergenic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1052943720 9:34150419-34150441 CTGAGTCATCAGGGTGAGCATGG + Intergenic
1057146025 9:92760118-92760140 CTGACTCCACAGGGGGAGTCTGG - Intronic
1057281170 9:93712732-93712754 GTCTGTCCCCAGGGTGAGCAAGG + Intergenic
1057318805 9:93992653-93992675 CTGTGTCCTCTGGAGGAGAAGGG - Intergenic
1057440512 9:95079660-95079682 CTGTGTCCAGAGGGCGGCCAGGG + Intronic
1058756568 9:108088210-108088232 CTGAGTCCCCAGGAGGAGAAGGG - Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059438708 9:114290798-114290820 CTTTCTTAACAGGGGGAGCAGGG + Exonic
1059545372 9:115170704-115170726 CTGTAGCCACCAGGGGAGCAGGG - Intronic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1060151496 9:121291789-121291811 CAGTGTCCACAGGGATAGAATGG - Intronic
1060678066 9:125534876-125534898 CTGGGTGCACATGGGAAGCAGGG - Intronic
1060937514 9:127524233-127524255 AAGTGTCCACAGGGGGAGGGAGG + Intronic
1061135159 9:128729558-128729580 CTGTGTCCTCAGTGGGCACAGGG + Intergenic
1061880786 9:133567905-133567927 CTGTGTCCAGAAAGGGGGCATGG - Intronic
1062046214 9:134425646-134425668 CTGTCCCCACAGGGGGACCTTGG - Intronic
1186509059 X:10117057-10117079 CCGTGCTCACAGGGTGAGCAGGG + Intronic
1189194806 X:39143854-39143876 CTGTGTTTGCAGTGGGAGCATGG + Intergenic
1191110514 X:56800138-56800160 CTGTGTCCTTAGGGGTGGCAAGG + Intergenic