ID: 1059438760

View in Genome Browser
Species Human (GRCh38)
Location 9:114291008-114291030
Sequence CTCCATTTTCACACAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059438760_1059438765 15 Left 1059438760 9:114291008-114291030 CCAGGGCCTGTGTGAAAATGGAG 0: 1
1: 0
2: 0
3: 23
4: 264
Right 1059438765 9:114291046-114291068 TTTCTCCGTCAGCAGTGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1059438760_1059438766 16 Left 1059438760 9:114291008-114291030 CCAGGGCCTGTGTGAAAATGGAG 0: 1
1: 0
2: 0
3: 23
4: 264
Right 1059438766 9:114291047-114291069 TTCTCCGTCAGCAGTGCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1059438760_1059438764 14 Left 1059438760 9:114291008-114291030 CCAGGGCCTGTGTGAAAATGGAG 0: 1
1: 0
2: 0
3: 23
4: 264
Right 1059438764 9:114291045-114291067 CTTTCTCCGTCAGCAGTGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 122
1059438760_1059438767 17 Left 1059438760 9:114291008-114291030 CCAGGGCCTGTGTGAAAATGGAG 0: 1
1: 0
2: 0
3: 23
4: 264
Right 1059438767 9:114291048-114291070 TCTCCGTCAGCAGTGCTTGGGGG 0: 1
1: 1
2: 0
3: 3
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059438760 Original CRISPR CTCCATTTTCACACAGGCCC TGG (reversed) Intronic
901381909 1:8879622-8879644 CTGGAATTTCACACAGACCCGGG + Intergenic
902295344 1:15463234-15463256 CTGCATTTTCAAACATGCCCTGG + Intronic
902863173 1:19260352-19260374 CACCATGTTCACCCAGGCCTAGG + Intergenic
903132407 1:21288975-21288997 CTCCAGGGTCACATAGGCCCAGG - Intronic
903259141 1:22121849-22121871 CTCCATTTAAACAGAGGCTCGGG + Intronic
904886966 1:33746086-33746108 CTCCACGGTCACATAGGCCCAGG - Intronic
905873641 1:41418780-41418802 CTACATTTTCACACATTCCCAGG + Intergenic
906012714 1:42543947-42543969 TTGCATTTTCAGACAGGCTCAGG + Intronic
906592597 1:47040948-47040970 CCCCATTCTCCCACAGCCCCTGG + Intronic
907239028 1:53070443-53070465 GTCCATTTTCAGACAGAGCCTGG - Intronic
907267561 1:53272094-53272116 CTCCATGTTAAAAAAGGCCCAGG - Intronic
907582674 1:55585994-55586016 CTCCACTCCCAAACAGGCCCTGG + Intergenic
907635003 1:56125384-56125406 ATCCATCTTCACCCAGGCCAAGG + Intergenic
912702783 1:111890648-111890670 CTCCATTTACACTCACTCCCTGG - Intronic
913038087 1:114993881-114993903 TTCCACTTTCCCCCAGGCCCTGG + Intronic
915042655 1:152981879-152981901 CTCCATCCTCACACAGTGCCTGG - Intergenic
921282872 1:213584785-213584807 CTCCATATTAACACATGCCCTGG - Intergenic
921544325 1:216455972-216455994 CTCCTCTCTCACACAGCCCCTGG - Intergenic
922635793 1:227169666-227169688 TGCCATTTTCACCCAGCCCCAGG + Intronic
1065434511 10:25693156-25693178 TTTCCTTTTCACACAGGTCCTGG - Intergenic
1065652984 10:27913286-27913308 CTCCATCTTCAAGTAGGCCCTGG + Intronic
1066982561 10:42431874-42431896 CTCCGATTCCCCACAGGCCCTGG + Intergenic
1067982453 10:51101849-51101871 CTCAATTTTACCCCAGGCCCAGG - Intronic
1068071374 10:52200214-52200236 CTCCACTATCAAACAGGCCCTGG + Intronic
1069748081 10:70728636-70728658 TCCCTTTTTCTCACAGGCCCAGG - Intronic
1070538086 10:77394270-77394292 CTTCATTTTCACAGCAGCCCTGG + Intronic
1073341155 10:102745461-102745483 CTCCCTTTTCCCCCAGCCCCTGG + Intronic
1074040448 10:109783192-109783214 CTCTATTTTCACAAAGCCCAGGG - Intergenic
1077735465 11:4786122-4786144 CTGCAGTTTCACACACACCCAGG - Intronic
1077984808 11:7341139-7341161 CTGCATTTTCATGCAGGTCCTGG - Intronic
1078464293 11:11538949-11538971 CTCCCTTTTCACTCAGTCCCAGG + Intronic
1079397942 11:20082185-20082207 CTTCACTGTCACACTGGCCCTGG - Intronic
1079977783 11:27113640-27113662 CTCCACCCTCACAAAGGCCCAGG - Intronic
1080122221 11:28691074-28691096 CAACAGTTTCACACAGCCCCAGG + Intergenic
1083994541 11:66265610-66265632 CTCCATGTTCCCCCAGACCCAGG - Intronic
1086008048 11:82063811-82063833 CTCCATCATCAAATAGGCCCTGG + Intergenic
1087949503 11:104203214-104203236 CTTCCTTTGCACACTGGCCCAGG - Intergenic
1090066878 11:123510811-123510833 CTCCACTCTGACACAGCCCCTGG - Intergenic
1090303039 11:125663737-125663759 CACCATTTTGACATAGGCCCTGG - Intronic
1091444078 12:533588-533610 CTCCCCTGTCTCACAGGCCCAGG - Intronic
1092101368 12:5886407-5886429 CTCCATTTCCCCTCAGCCCCAGG - Intronic
1092612905 12:10190179-10190201 TTCCATTTTCCCACAGACTCTGG - Exonic
1092738644 12:11607826-11607848 CTGCAGTTTCCCACAGTCCCTGG + Intergenic
1094431091 12:30369896-30369918 TGCCATTTTCTAACAGGCCCAGG - Intergenic
1094699992 12:32860387-32860409 CCTCATGTTCACACAGGCCTAGG + Intronic
1095387261 12:41665689-41665711 CCCCATCCTCCCACAGGCCCTGG - Intergenic
1104099964 12:125598391-125598413 CTCGATTGTCTCACAGGCCATGG - Intronic
1104386411 12:128355191-128355213 CTCCATTTTCACAGGGGCACTGG + Intronic
1105979464 13:25503536-25503558 CTCCATTTGCACATGGGGCCAGG + Intronic
1108714813 13:53068744-53068766 ACCCATTTTCACAGAGCCCCTGG + Intergenic
1108728077 13:53202462-53202484 TTCCATTTCCACAGGGGCCCAGG + Intergenic
1109468145 13:62766109-62766131 CTGCATTTTTACAAAGTCCCAGG + Intergenic
1110273462 13:73616840-73616862 TTCCATTTTAGCACAGTCCCAGG - Intergenic
1110504612 13:76271209-76271231 CTCCATCCCCAGACAGGCCCTGG + Intergenic
1111877309 13:93913315-93913337 CTCCCTTTGCACAGAGGCCTTGG + Intronic
1111956164 13:94760948-94760970 CTCCGTTTTCTCAAAGGCCTAGG + Intergenic
1112073496 13:95881737-95881759 CACCATTTTCACACTGTTCCAGG - Intronic
1114132619 14:19809917-19809939 TTCCATTCTCAAATAGGCCCTGG + Intronic
1114719506 14:24865603-24865625 CTCCATGCTCACACAGGGCTGGG + Intronic
1116916581 14:50532044-50532066 CTCCATCTTCACTTAGGGCCCGG + Exonic
1117974696 14:61285931-61285953 TTCCATTTACACAGAGTCCCAGG + Intronic
1118807468 14:69250567-69250589 CCCCAGCTGCACACAGGCCCAGG - Intergenic
1119327689 14:73771153-73771175 CTCCATTTTCTCTCTGACCCTGG + Intronic
1119886958 14:78151493-78151515 GGCTCTTTTCACACAGGCCCAGG - Intergenic
1120202819 14:81555652-81555674 CTCCATTTGTACTCATGCCCTGG - Intergenic
1121800764 14:96772378-96772400 CTCCCTTTTCAGAAAGGCCCTGG - Intergenic
1122288796 14:100668494-100668516 CCCCATGTACACACAGTCCCAGG + Intergenic
1123114817 14:105889924-105889946 CACCACTTACACACAGGCCAGGG - Intergenic
1123575702 15:21665801-21665823 TTCCATTCTCAAATAGGCCCTGG + Intergenic
1123612322 15:22108274-22108296 TTCCATTCTCAAATAGGCCCTGG + Intergenic
1124022808 15:25939524-25939546 CTGCATTTTCACAAGGGCCTTGG + Intergenic
1125738460 15:41944622-41944644 CTACATTTTCAAATCGGCCCAGG + Intronic
1126419515 15:48456718-48456740 CTCCATTTTCACAGACCCCTGGG + Exonic
1127855094 15:62947679-62947701 CTGCATTTTCACAAACCCCCAGG + Intergenic
1128239815 15:66094263-66094285 CCTGATGTTCACACAGGCCCAGG + Intronic
1128526535 15:68415983-68416005 CTCCCCTTTCAGCCAGGCCCTGG + Intronic
1128770185 15:70276236-70276258 GGCCATTTTCAGACAGTCCCTGG + Intergenic
1128893708 15:71353990-71354012 CTCCTTTTCCAGACAGCCCCTGG - Intronic
1129264923 15:74388397-74388419 CTCCATTTTTACTCCTGCCCTGG + Intergenic
1131259082 15:90879353-90879375 CTCCCTCTGCATACAGGCCCTGG - Intronic
1132283236 15:100638845-100638867 CCCCACTCTCCCACAGGCCCTGG + Intronic
1202984570 15_KI270727v1_random:400046-400068 TTCCATTCTCAAATAGGCCCTGG + Intergenic
1132455062 16:17678-17700 CTCCATCTTCACCGACGCCCAGG - Exonic
1133535867 16:6701931-6701953 CTCCATCCTCAAGCAGGCCCCGG - Intronic
1134670071 16:16048126-16048148 CTCCTTTGTCCCACAGGCCCTGG + Exonic
1134760394 16:16709505-16709527 CTACATTTTCACAAGGTCCCTGG + Intergenic
1134901569 16:17942827-17942849 CTCCTTCTTCCCACAGGACCAGG + Intergenic
1134985677 16:18649700-18649722 CTACATTTTCACAAGGTCCCTGG - Intergenic
1135856352 16:26014498-26014520 CTCCATCCTCACATAGGTCCTGG + Intronic
1135967576 16:27048781-27048803 CTCCATCGTGACCCAGGCCCAGG + Intergenic
1140558494 16:75948750-75948772 TTTCATTTTCAGACAGGCCTAGG + Intergenic
1140576720 16:76179110-76179132 CTCTATTTCCACCCAAGCCCAGG - Intergenic
1140743519 16:77962149-77962171 CTCCATTTGCACTCTTGCCCAGG - Intronic
1141809750 16:86367953-86367975 CTGCATTTTCACAAAGTCCCCGG - Intergenic
1143020881 17:3916704-3916726 CTCCAGCTTCCCCCAGGCCCTGG - Intergenic
1144320727 17:14116916-14116938 CACAATGTTCACACAGGACCAGG - Intronic
1144573997 17:16417618-16417640 CTCCATCTGCACAGAGGTCCTGG + Exonic
1146929886 17:36769375-36769397 CTCCATGTCCAGACAGGGCCAGG - Intergenic
1148903821 17:50898924-50898946 CTCCCCATTCACACAGGCCCAGG - Intergenic
1149559807 17:57600565-57600587 CTCCATTTTAAAAAATGCCCAGG - Intronic
1150115699 17:62547393-62547415 CTAGATTTTAACACAGGACCAGG + Intronic
1151330286 17:73402397-73402419 CTCAATTCTCACAGAGACCCAGG + Intronic
1151390883 17:73786033-73786055 CTCCATTTTTAAAAAGGCGCTGG + Intergenic
1151571384 17:74927547-74927569 TTCCCTGTTCACACAGGGCCTGG + Intronic
1151703211 17:75754067-75754089 CCCCAGTTTCAGCCAGGCCCGGG + Intronic
1152290997 17:79440299-79440321 CACCATTTTCAAAAATGCCCTGG - Intronic
1152383604 17:79955273-79955295 CTCCATGACCACACAGGGCCTGG - Intronic
1152388980 17:79991865-79991887 CGCCATCTTCACAGAGGCTCCGG + Intronic
1152567939 17:81108471-81108493 CTCCATAGTCATCCAGGCCCTGG - Exonic
1155171058 18:23267120-23267142 CCCCATTTTCAGCCAGGCTCTGG - Intronic
1157554157 18:48602089-48602111 GCCCATGTTCACACAGGCTCAGG - Intronic
1158422324 18:57306195-57306217 CTCCTTCTTCACACATTCCCTGG - Intergenic
1159920268 18:74221363-74221385 TTCCATCTTCACACAGGCTGCGG + Intergenic
1160090877 18:75825616-75825638 CTCCATCTTCCCAGTGGCCCAGG + Intergenic
1161686093 19:5703366-5703388 CTCCATTTCCCCACCTGCCCTGG - Intronic
1161741424 19:6023189-6023211 CTCCCTTCTCAGACAGCCCCAGG - Intronic
1165658500 19:37554149-37554171 CTCCACTCTCAAGCAGGCCCTGG + Intronic
1167499455 19:49836965-49836987 TTCCTTTTTAACACACGCCCCGG + Exonic
925140444 2:1546684-1546706 CTCCAGGTTCACAGAGGCTCTGG - Intergenic
926560722 2:14414507-14414529 TTCCATATTCCCACAGGCCTAGG - Intergenic
929533292 2:42765254-42765276 CTCCATATGCAGACAGGCCTGGG + Intergenic
930103569 2:47621212-47621234 CTCCATCTTGCCACTGGCCCAGG + Intergenic
933335434 2:80952190-80952212 CTCCACTTTCAGATAGGCTCTGG + Intergenic
933356562 2:81217604-81217626 ACCCATTTCCATACAGGCCCTGG + Intergenic
933653236 2:84865768-84865790 CTCCATGTTCACACATCACCAGG - Intronic
934050390 2:88205773-88205795 CTCAATTTCTACAAAGGCCCAGG - Intergenic
935350556 2:102148706-102148728 CTCCATACTCACACAAGCCCTGG - Intronic
935584094 2:104785057-104785079 CTGCATTTTAACACAGCTCCAGG + Intergenic
936256818 2:110923128-110923150 CTTCACTTTAACACAAGCCCAGG + Intronic
937267285 2:120624569-120624591 CTCCCTTTTGGCACAAGCCCAGG + Intergenic
937268895 2:120634597-120634619 CTCCATTCTCTGAGAGGCCCAGG - Intergenic
937700046 2:124853812-124853834 CTCCATCCTCACGTAGGCCCTGG + Intronic
938121454 2:128637012-128637034 CTCCGTTTACACACATTCCCTGG - Intergenic
938545195 2:132322536-132322558 CTCCTGCTTCACCCAGGCCCTGG + Intergenic
938562846 2:132489905-132489927 TTCCCTTTGGACACAGGCCCAGG + Intronic
940121165 2:150267866-150267888 CTCCTCTTTCACAAAGGCCAAGG - Intergenic
940545868 2:155084428-155084450 CTCCATTCTCAAGTAGGCCCTGG + Intergenic
946328958 2:218999238-218999260 CTCCACTGTCACACAGACCCTGG + Intergenic
947109955 2:226707964-226707986 CTCCATTTCCACACAAACTCAGG + Intergenic
948795875 2:240401868-240401890 CTCCTTCTTCTCCCAGGCCCTGG - Intergenic
949041131 2:241850425-241850447 CTCCACCTTTACACATGCCCAGG - Exonic
1171524904 20:25801263-25801285 ATACATTTACACAGAGGCCCAGG - Intronic
1171551923 20:26054620-26054642 ATACATTTACACAGAGGCCCAGG + Intergenic
1171571264 20:26253804-26253826 ATACATTTACATACAGGCCCAGG - Intergenic
1171874048 20:30555319-30555341 CTCCTGCTTCACTCAGGCCCTGG + Intergenic
1172129033 20:32643572-32643594 CACCATTGTCACATAGGCCTGGG + Intergenic
1172198627 20:33109579-33109601 CACCAATTTCAAAAAGGCCCTGG - Intronic
1174278806 20:49423323-49423345 CACCCCTTTCACCCAGGCCCAGG - Intronic
1174432782 20:50482756-50482778 CTCCATTATCTCCCAGACCCAGG - Intergenic
1175028250 20:55926288-55926310 CTCTAGAATCACACAGGCCCAGG - Intergenic
1176046578 20:63096093-63096115 CCCCAGCTTCACTCAGGCCCTGG - Intergenic
1177086574 21:16712392-16712414 CCCCATCTCCTCACAGGCCCTGG + Intergenic
1178410113 21:32356507-32356529 CTGGATTTTCACAAAGACCCAGG + Intronic
1178644072 21:34370490-34370512 ATCCAATTTCACACAGACGCTGG + Exonic
1179188740 21:39106045-39106067 CTCCATTTTTATACATGCCTTGG - Intergenic
1180260003 21:46662338-46662360 CTCCACTGCCACACATGCCCAGG - Intronic
1180767691 22:18355919-18355941 CTTGATTTTCAAACAGGACCCGG - Intergenic
1180778617 22:18506471-18506493 CTTGATTTTCAAACAGGACCCGG + Intergenic
1180791280 22:18577001-18577023 GTTCATATTCACACAGGCCTGGG - Intergenic
1180811342 22:18763779-18763801 CTTGATTTTCAAACAGGACCCGG + Intergenic
1181081036 22:20415260-20415282 CCCCATCCTCAGACAGGCCCCGG + Intergenic
1181188712 22:21123594-21123616 CTTGATTTTCAAACAGGACCCGG - Intergenic
1181197494 22:21198033-21198055 CTTGATTTTCAAACAGGACCCGG + Intergenic
1181210487 22:21286899-21286921 CTTGATTTTCAAACAGGACCCGG + Intergenic
1181230457 22:21418310-21418332 GTTCATATTCACACAGGCCTGGG + Intronic
1181248192 22:21516556-21516578 GTTCATATTCACACAGGCCTGGG - Intergenic
1183025201 22:35060026-35060048 CTCCACTCTCAAGCAGGCCCTGG - Intergenic
1183267550 22:36838596-36838618 CTCCAGTCACACACAGGCTCAGG - Intergenic
1183454940 22:37917548-37917570 CTCCCGCTTCACACGGGCCCGGG - Intronic
1183674693 22:39292679-39292701 CCCCAATATCACACAGGACCAGG + Intergenic
1184822032 22:46916674-46916696 CACCAGTTTCGCTCAGGCCCTGG + Intronic
1203229306 22_KI270731v1_random:96802-96824 CTTGATTTTCAAACAGGACCCGG - Intergenic
951085842 3:18511607-18511629 CTCCTTTTTCACAGTGGCTCAGG + Intergenic
952643144 3:35622463-35622485 CTCCACCTTCAAGCAGGCCCTGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954661460 3:52229045-52229067 CCCCATTTTCACCCGGGCCGCGG + Exonic
955405788 3:58624920-58624942 CTCCAGCTCCACATAGGCCCTGG + Intronic
958592337 3:96174195-96174217 TTTCATTTTCTGACAGGCCCAGG + Intergenic
958922760 3:100124702-100124724 CTGCTTTCTCACACGGGCCCAGG - Intronic
959128248 3:102317621-102317643 CTCCACTTTCAAGCAGGCCCTGG + Intronic
959363568 3:105427133-105427155 CTCCATTTTCACCCTGGGCATGG - Intronic
959520642 3:107319650-107319672 CTCCATTGACACTCAGGGCCGGG - Intergenic
960518976 3:118633264-118633286 TTCCATAATCACACAGGCCAAGG - Intergenic
964822441 3:160786752-160786774 CTCCATCCTCAAATAGGCCCTGG + Intronic
965036714 3:163449333-163449355 CTCCACTTTCAAGTAGGCCCTGG - Intergenic
966070396 3:175870494-175870516 CCCCACTTCCAGACAGGCCCTGG + Intergenic
966442719 3:179964158-179964180 CTCCACCTTCAAGCAGGCCCTGG + Intronic
966797981 3:183733966-183733988 CTCCAGTTTCACACACACCAAGG - Intronic
967986122 3:195096536-195096558 CTCCATTTTCCCGAAGGCCGAGG - Intronic
968644872 4:1735423-1735445 CCCCAGCTGCACACAGGCCCAGG + Intronic
973020778 4:45203679-45203701 GTCCATTTTTACACAGTGCCAGG + Intergenic
975259243 4:72276780-72276802 CTAAATTTTCAAGCAGGCCCAGG - Intergenic
978282756 4:107036845-107036867 CTCCAGCTTCACACACTCCCTGG - Intronic
979024078 4:115545435-115545457 TTCCACTTTCTGACAGGCCCAGG - Intergenic
979276119 4:118815720-118815742 CTCCTTTCTCACACAGGTTCAGG - Exonic
981973059 4:150689296-150689318 CTCCATCCCCATACAGGCCCCGG - Intronic
982055031 4:151540088-151540110 CAGCATTTTCACATAGGCCAAGG - Intronic
982499055 4:156130972-156130994 CTGCTTTTTCATACAGACCCTGG + Intergenic
982691393 4:158551299-158551321 CTCCATTTTTCCCCAGACCCTGG - Intronic
983423432 4:167550635-167550657 CCACAATTTCACACAGACCCAGG - Intergenic
985794240 5:1950192-1950214 CTCCAAGTTCACAGAGTCCCGGG + Intergenic
986170196 5:5308558-5308580 CTTCCTTTTAGCACAGGCCCTGG - Intronic
986196321 5:5539367-5539389 CGCCACTGTCACACAGCCCCTGG - Intergenic
986273709 5:6255748-6255770 CTCCCCTCTCACAGAGGCCCTGG + Intergenic
986432795 5:7698329-7698351 CCCCATTTTCACACAGTTCTTGG - Exonic
987804057 5:22739711-22739733 CTCCATTTCCTCCCAGCCCCTGG + Intronic
988911906 5:35851905-35851927 CTCCATTTGCACAGAGGACTGGG + Intergenic
989692113 5:44157212-44157234 TGCCATTTTCCAACAGGCCCAGG + Intergenic
990063802 5:51686671-51686693 CACAATATTTACACAGGCCCTGG - Intergenic
990289066 5:54330372-54330394 CTCCATCTTCACACCTGGCCTGG + Intergenic
990740969 5:58912446-58912468 TTCCATTCTCACACAGCCCTGGG + Intergenic
991495822 5:67224878-67224900 CCCCATCTCCACACAGGCCCCGG + Intergenic
994023792 5:95058942-95058964 CACCCTTTTCACCCAGGCCCAGG + Intronic
994040181 5:95249994-95250016 CCCCACTCTCCCACAGGCCCTGG - Intronic
994175283 5:96703584-96703606 CTCCACTTACACACAGGCAGGGG + Intronic
995647179 5:114326258-114326280 GTACATTTTCACAGAGGCCACGG + Intergenic
998771015 5:145545606-145545628 CACCATTTTTAAACAGGCTCAGG + Intronic
999636877 5:153632260-153632282 CTCCATTCTCACCCTGGCCTAGG - Intronic
1003521553 6:6862725-6862747 CTTCATTTTCTCACAGTTCCAGG + Intergenic
1005549099 6:26896906-26896928 CTCCCTTTGCGCCCAGGCCCGGG + Intergenic
1005586282 6:27279564-27279586 CTCCATTTACCCACAGGGGCTGG + Intergenic
1006586424 6:35117637-35117659 ATCCATTTTCATCCAGCCCCGGG + Intergenic
1006873481 6:37275132-37275154 CTCCATTTAAACACAGTCCCAGG - Intronic
1007237757 6:40403295-40403317 CCCCATTATCACTCAGGCCCTGG - Intronic
1007728891 6:43933728-43933750 CTCCATTCTCACCCCAGCCCCGG - Intergenic
1008562076 6:52733431-52733453 TTCCTTTTTGATACAGGCCCTGG - Intergenic
1010939878 6:81904318-81904340 CTCCACACTCACGCAGGCCCTGG - Intergenic
1011666917 6:89643360-89643382 CTTCATTTTTACACAGCCCAAGG + Exonic
1012500855 6:99886829-99886851 GTCCAGTTTCACATTGGCCCAGG + Intergenic
1013148099 6:107414916-107414938 CTCTACCTTCACACAGTCCCAGG - Intronic
1013302088 6:108813262-108813284 CCCCATTCCCAGACAGGCCCTGG + Intergenic
1013354071 6:109332126-109332148 CTGCATTTTGACACAAGCACAGG + Intergenic
1015076237 6:129161657-129161679 CACCCTTTTCAAGCAGGCCCTGG + Intronic
1018344754 6:162888727-162888749 AGTCATTTTCATACAGGCCCTGG + Intronic
1018359752 6:163055199-163055221 CTCCATTTCCACACTGTCCCCGG - Intronic
1018733902 6:166673212-166673234 CTCCACGTGCACACAGACCCAGG + Intronic
1018861098 6:167711407-167711429 CTCCACATGCACACAGGCTCAGG - Intergenic
1021502522 7:21346403-21346425 CTCCAAAGTCAGACAGGCCCAGG + Intergenic
1022477375 7:30720341-30720363 CTCCATAGCCACACAGGCTCTGG - Intronic
1023167427 7:37356608-37356630 CTCCCCTATCACACGGGCCCCGG - Intronic
1024210981 7:47203739-47203761 CTGCATTTTCACAGGGACCCAGG - Intergenic
1024277817 7:47693122-47693144 CTCATTCTTCACACAGGCCCAGG + Intergenic
1024503562 7:50140836-50140858 CTCAACTTTCTCTCAGGCCCAGG + Intronic
1024927275 7:54630473-54630495 CTCCACTCTCAAGCAGGCCCTGG + Intergenic
1025232907 7:57214631-57214653 CTCCATCCTCCCTCAGGCCCTGG - Intergenic
1025300577 7:57816910-57816932 ATACATTTACACAGAGGCCCAGG + Intergenic
1032045423 7:128603101-128603123 CTAGATTTTAACACAGGACCAGG + Intergenic
1032507402 7:132446012-132446034 CTCCAAGTTAACACAAGCCCAGG + Intronic
1032775604 7:135109724-135109746 CTGCTTTTTCACACAGGCACTGG - Intronic
1033136833 7:138792278-138792300 CTCCATTTACCCACTCGCCCAGG - Intronic
1033144447 7:138859395-138859417 CTCAAAATTCACACAGGCCTGGG - Intronic
1033712449 7:143961989-143962011 GTCCATTCTCAGACAAGCCCAGG - Intergenic
1034390901 7:150786968-150786990 CTGCATTTTCACAAGGTCCCAGG - Intergenic
1035723646 8:1811973-1811995 CCCCAGGTTCACGCAGGCCCAGG + Intergenic
1039708739 8:40034063-40034085 ATCCATTTTACCCCAGGCCCTGG + Intergenic
1040954644 8:52967398-52967420 CTCCACCTTCACATAGGTCCCGG + Intergenic
1041730436 8:61056927-61056949 CACCATTCTGACAAAGGCCCTGG - Intergenic
1042108644 8:65355861-65355883 CTGCTTTTTCACTCAGGTCCTGG - Intergenic
1042203808 8:66307885-66307907 CCACATTTTCACACCAGCCCAGG + Intergenic
1042207545 8:66344513-66344535 CTTCTTTTTCACAAAGCCCCTGG - Intergenic
1050026156 9:1336269-1336291 CTCCATTTTGACACCTTCCCAGG + Intergenic
1051487789 9:17626985-17627007 CTCCACTTTCTGTCAGGCCCTGG + Intronic
1053054167 9:34984188-34984210 CTCCACACTCACACAGTCCCAGG + Intergenic
1053793252 9:41701770-41701792 ATACATTTACACAGAGGCCCAGG - Intergenic
1054181660 9:61913782-61913804 ATACATTTACACAGAGGCCCAGG - Intergenic
1054471697 9:65544199-65544221 ATACATTTACACAGAGGCCCAGG + Intergenic
1055131871 9:72784926-72784948 CTCCACCCTCACATAGGCCCTGG - Intronic
1055503471 9:76924934-76924956 CTCCATTTGCACACCACCCCAGG + Intergenic
1059184807 9:112258609-112258631 CTCCATTTTACCAGAGGCTCAGG + Intronic
1059438760 9:114291008-114291030 CTCCATTTTCACACAGGCCCTGG - Intronic
1059461495 9:114433438-114433460 ATCCATTTTAACACAGGCTTGGG - Intronic
1059536655 9:115087028-115087050 CTCCATTTACGCACTTGCCCTGG + Exonic
1060520901 9:124293552-124293574 CTCGATTTTCAAAAAGGCCCTGG + Intronic
1061869953 9:133515275-133515297 CTCCAGGTCCACACAGGCCATGG + Intronic
1062491282 9:136806272-136806294 CCCCAGTCTCACAAAGGCCCCGG + Intronic
1203775452 EBV:70568-70590 CTCCCTTTTGACAGAGGCCGTGG - Intergenic
1186850922 X:13579251-13579273 CTCCACTCTCAAATAGGCCCTGG + Intronic
1187168014 X:16822868-16822890 CTGCATTTTAACAAATGCCCGGG + Intronic
1188199702 X:27283243-27283265 CTCTATGTCCACACAGGCTCTGG - Intergenic
1190039092 X:47054660-47054682 CTCCATTTCTACACAGACCGAGG - Intronic
1191662661 X:63667075-63667097 CCCTATCTTCACATAGGCCCTGG - Intronic
1193512593 X:82422988-82423010 CTCCATTCTCAAGTAGGCCCTGG - Intergenic
1195707321 X:107747248-107747270 CCCCCTTATCACACACGCCCTGG + Intronic
1196028812 X:111073082-111073104 CTCCATGTTCCCACAGCCACAGG + Intronic
1196579944 X:117367076-117367098 CTCCACTTTCAAGTAGGCCCTGG + Intergenic
1198280809 X:135140248-135140270 CTCCACCGTCACATAGGCCCAGG + Intergenic
1198290150 X:135232266-135232288 CTCCACCGTCACATAGGCCCAGG - Intergenic
1200795848 Y:7340587-7340609 CTCCATCTTCAGGCAGGCCCAGG + Intergenic