ID: 1059440402

View in Genome Browser
Species Human (GRCh38)
Location 9:114303533-114303555
Sequence CATGAAAAGCACCTGTAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059440402_1059440403 15 Left 1059440402 9:114303533-114303555 CCGGGCTACAGGTGCTTTTCATG 0: 1
1: 0
2: 2
3: 21
4: 497
Right 1059440403 9:114303571-114303593 TCCTTTCAGCAGTTCTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059440402 Original CRISPR CATGAAAAGCACCTGTAGCC CGG (reversed) Intronic
901289708 1:8114419-8114441 AATAAAAAGCGCATGTAGCCGGG + Intergenic
902141695 1:14361988-14362010 CAAGGAAAGGTCCTGTAGCCAGG + Intergenic
902392380 1:16114131-16114153 CATGAGAATCACCTGAATCCAGG + Intergenic
902425398 1:16317323-16317345 CATGAAAATCACTTGAACCCAGG + Intronic
902510474 1:16964222-16964244 CAGGAAAAGCACTTGAACCCTGG - Intronic
903509319 1:23862460-23862482 AAGGAAAATCACCTTTAGCCAGG - Intronic
903922327 1:26809124-26809146 CATGAAAATCACTTGAACCCAGG + Intergenic
904728826 1:32572486-32572508 CATGAGAATCACCTGAACCCAGG - Intronic
904767309 1:32860358-32860380 CATGAAAATCACTTGAACCCAGG - Intergenic
905718352 1:40173604-40173626 CATGAAAATCACCTGAATCCAGG - Intronic
905838337 1:41150408-41150430 CAGGAGAATCACCTGAAGCCGGG + Intronic
905902485 1:41590787-41590809 CAAGACAGGCACCTGTAGCAAGG + Intronic
906029862 1:42710180-42710202 CAGGAAAATCACTTGAAGCCAGG + Intergenic
906408143 1:45558319-45558341 CATGAGAATCACCTGAACCCGGG - Intronic
906690106 1:47786930-47786952 CAGGAGAATCACCTGAAGCCAGG - Intronic
907043301 1:51282581-51282603 CAGGAAAATCACCTGAACCCTGG + Intergenic
908204166 1:61828148-61828170 CAGGAAAATCACTTGAAGCCGGG + Intronic
908459970 1:64339773-64339795 TATAAGAAGCAGCTGTAGCCAGG - Intergenic
908677142 1:66617991-66618013 CATGAGAAGCACCTGATGCCAGG - Intronic
909787063 1:79627074-79627096 AATGAAAAGGAACTGAAGCCAGG + Intergenic
909972753 1:82009891-82009913 CATGAAAAGCAGCAGTTTCCAGG - Intergenic
910698772 1:90049768-90049790 CATGAAAATTAGCTGTAGCATGG - Intergenic
911146455 1:94557000-94557022 CATGAGAATCACTTGAAGCCAGG - Intergenic
911196932 1:95004312-95004334 CATGAGAATCACGTGAAGCCAGG - Intronic
912396996 1:109353233-109353255 CAGGAGAAGCACTTGTACCCGGG + Intronic
912446525 1:109740601-109740623 CGCGAAAAGCACCACTAGCCAGG + Intronic
912560201 1:110545935-110545957 CATGAAAATCACTTGAAACCAGG - Intergenic
915117960 1:153612251-153612273 CAAGAAAAGCAGCTCAAGCCGGG + Intronic
915130412 1:153691804-153691826 CATGAAAATCACTTGAACCCAGG + Intronic
915140368 1:153764155-153764177 CTTGAAGAGCTCCTGTAGGCAGG - Exonic
915525619 1:156474354-156474376 CATGAGAATCACCTGAACCCAGG + Intronic
916253279 1:162759860-162759882 CATGAATACCACGTGTGGCCCGG + Exonic
916468489 1:165096371-165096393 CATGAAAATCACCTGAACCCAGG + Intergenic
918263631 1:182819516-182819538 CATGAGAATCACCTGAACCCAGG + Intronic
918314701 1:183313570-183313592 CATGAGAATCACCTGAACCCAGG - Intronic
919441757 1:197643245-197643267 CACGAAAATCACCTGAACCCGGG - Intronic
920882564 1:209894150-209894172 CATGAAAATCACTTGAACCCAGG - Intergenic
920943156 1:210503050-210503072 CATGAGAATCACCTGAACCCAGG - Intronic
921085913 1:211792401-211792423 CACAAAAAGCAGCTTTAGCCTGG - Intronic
921858042 1:220010001-220010023 CATGAGAATCACTTGAAGCCGGG + Intronic
922125894 1:222723366-222723388 CAGGAGAATCACCTGAAGCCAGG - Intronic
923212917 1:231821995-231822017 CTTGAAAAGCAGTTGTAGGCCGG - Intronic
923272527 1:232370646-232370668 CAAGAAAACCACCTGAACCCGGG + Intergenic
923413522 1:233732753-233732775 CATGAAAATCACTTGAAACCTGG + Intergenic
923574275 1:235143643-235143665 CATGAAAATCACTTGAACCCGGG + Intronic
924212212 1:241782193-241782215 CAGGAGAATCACCTGAAGCCAGG + Intronic
924345638 1:243070413-243070435 CAGGCAAATCACCTGAAGCCTGG + Intergenic
924549683 1:245063812-245063834 CAGGAGAATCACCTGAAGCCAGG - Intronic
1063922951 10:10949706-10949728 CATGAGAACCACCTGAAGCTGGG + Intergenic
1064000112 10:11656793-11656815 CATGAGAATCACCTGAACCCAGG - Intergenic
1064006470 10:11703088-11703110 CATGAGAATCACTTGAAGCCGGG - Intergenic
1064564958 10:16630654-16630676 CATGAAACGCACCTGTAGCGTGG - Intronic
1065053493 10:21819306-21819328 CAGGAAAATCACCTGAACCCAGG + Intronic
1065625833 10:27627326-27627348 CATGAAAATCACTTGAACCCAGG + Intergenic
1065805341 10:29388877-29388899 CATGAGAATCACCTGAACCCAGG + Intergenic
1065843024 10:29720937-29720959 CATGAGAATCACCTGAATCCAGG - Intronic
1065994840 10:31048626-31048648 CAGGAGAATCACCTGAAGCCGGG - Intergenic
1067102733 10:43344610-43344632 CAGGAAAATCACCTGAAGCCAGG + Intergenic
1068454661 10:57238882-57238904 CATGAAAAGAACCTGGAGGGGGG + Intergenic
1069021435 10:63492579-63492601 CATGAGAACCACCTGAACCCAGG + Intergenic
1069484360 10:68812019-68812041 CATGAGAAGCACTTGAACCCAGG - Intergenic
1070168916 10:73917869-73917891 CAAGAAGAACACCTGTGGCCAGG + Intronic
1070558442 10:77547614-77547636 CATGAAAGGCACATGTTTCCAGG + Intronic
1070877673 10:79828089-79828111 CATAAAAAACACCTGTCGGCCGG - Intergenic
1071644171 10:87344132-87344154 CATAAAAAACACCTGTCGGCCGG - Intergenic
1072154440 10:92711773-92711795 CATGAAAATCCCTTGAAGCCAGG - Intergenic
1072416781 10:95253561-95253583 CATGACAATCACCTGAACCCGGG + Intronic
1072590971 10:96828265-96828287 CAGGAAAATCACTTGAAGCCGGG - Intergenic
1073220829 10:101872399-101872421 CATAAAAAGCTGCTCTAGCCGGG + Intronic
1073605590 10:104892628-104892650 CATGAGAATCACTTGTACCCGGG + Intronic
1074097457 10:110326487-110326509 AATTAAAAGCAAATGTAGCCAGG - Intergenic
1074124357 10:110516398-110516420 CATGAGAATCACCTGAACCCGGG - Intergenic
1074310320 10:112316798-112316820 CATGAGAATCACTTGAAGCCGGG + Intergenic
1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG + Intronic
1075043816 10:119130095-119130117 CATGACAATCACCTGAACCCGGG - Intronic
1075138307 10:119807178-119807200 CATGAAAATCACTTGAACCCAGG + Intronic
1075437388 10:122455108-122455130 CATCAGAAGCACCTGAAGGCTGG - Intronic
1075535721 10:123270656-123270678 TTTGAAAATCACCTCTAGCCTGG + Intergenic
1076999841 11:317055-317077 GATTAAATTCACCTGTAGCCTGG - Intergenic
1078458115 11:11491508-11491530 CAGGAAGAGCCCCTGCAGCCAGG - Intronic
1079028996 11:16971914-16971936 CATGAGAATCACCTGAACCCAGG - Intronic
1079160210 11:17985436-17985458 CATTAAAAGCACCTCCAGCCAGG + Intronic
1080210774 11:29782340-29782362 CTGGAACAGGACCTGTAGCCTGG - Intergenic
1080278400 11:30528346-30528368 CATGAGAATCACCTGAACCCGGG - Intronic
1080636447 11:34128058-34128080 AAGAAAAATCACCTGTAGCCAGG + Intronic
1080757229 11:35213557-35213579 CATGAAAATCACTTGAACCCAGG + Intronic
1080808478 11:35678699-35678721 CATGAGAATCACCTGAACCCAGG - Intronic
1081635714 11:44720410-44720432 CAGGAAAAGCACTTGAAGCCAGG - Intergenic
1081695726 11:45107920-45107942 CATGAGAATCACTTGTACCCTGG - Intronic
1081705882 11:45181593-45181615 CAACAAAAACAGCTGTAGCCCGG - Intronic
1082034612 11:47634863-47634885 CAGGAGAAGCACTTGTACCCAGG - Intronic
1082089139 11:48075234-48075256 CAGGAAAATCACCTGAACCCAGG - Intronic
1082655966 11:55857320-55857342 AAGGAAAAGGACCTGGAGCCTGG - Intergenic
1083174624 11:60941891-60941913 CAGGAAAAGCACCTGGAGGGTGG - Intronic
1083371212 11:62183328-62183350 CATGAAAATCACTTGAACCCTGG - Intergenic
1083461382 11:62814716-62814738 CAGGAAAATCACCTGAACCCGGG - Intronic
1084564967 11:69923501-69923523 CATGAAATGCAGCTGGAGCTAGG + Intergenic
1084822241 11:71700129-71700151 CATGAAAATCACTTGAACCCAGG + Intergenic
1085604258 11:77882977-77882999 CAGGAGAAGCACCTGAACCCAGG + Intronic
1085631397 11:78120007-78120029 CATGAGAATCACCTGAACCCAGG + Intronic
1087070182 11:94071870-94071892 GATGCAAAGCACCTGTGGCATGG + Intronic
1090260152 11:125313589-125313611 CTGGAAAAGCACATGTACCCAGG + Intronic
1090337825 11:125985560-125985582 CATGGAAAGCACTTAGAGCCTGG + Intronic
1090902246 11:131043366-131043388 CATGGAATGCACCTGCAGTCAGG + Intergenic
1091246075 11:134096067-134096089 CATGAGAATCACCTGAACCCAGG - Intronic
1091580326 12:1783489-1783511 CAGGAGAATCACCTGAAGCCGGG - Intronic
1092932346 12:13327942-13327964 CAGGAGAATCACCTGAAGCCAGG + Intergenic
1092979463 12:13779134-13779156 CAGGAGAAGCACTTGAAGCCAGG - Intronic
1093215334 12:16355299-16355321 CATGAGAAGCACTTGAACCCAGG - Intronic
1093336504 12:17911940-17911962 CATGGAAAGCACCTGTCCCATGG + Intergenic
1093516537 12:19993559-19993581 CAGGAAAAGCATCTGTTGTCAGG + Intergenic
1093719610 12:22424411-22424433 CATGAGAATCACCTGAACCCAGG + Intronic
1093720106 12:22431051-22431073 CATGAGAATCACCTGAACCCAGG + Intronic
1093974579 12:25407289-25407311 CAGGAGAAGCACTTGAAGCCAGG - Intergenic
1096210400 12:49760930-49760952 CAGGAGAAACACCTGAAGCCGGG - Intronic
1096283249 12:50275273-50275295 CATGAGAATCACCTGAACCCAGG + Intronic
1096299243 12:50411440-50411462 CATGAAAATCACTTGAACCCGGG - Intronic
1096802197 12:54117988-54118010 CAGGAAAATCACTTGAAGCCTGG + Intergenic
1097867115 12:64568122-64568144 CAGGAAAATCACTTGAAGCCAGG - Intergenic
1098023786 12:66181914-66181936 CATGAAAATAACCTGTAGCCAGG - Intergenic
1098379017 12:69848962-69848984 CATGAAAATCACTTGAACCCGGG - Intronic
1098693708 12:73523992-73524014 CATGAAAATCACTTGAACCCAGG + Intergenic
1099074625 12:78091499-78091521 CATAAAATTCACCTGTGGCCGGG + Intronic
1099968207 12:89473566-89473588 CAGGAAAACCACCTGAACCCAGG + Intronic
1100636263 12:96437609-96437631 CAGGAGAATCACCTGTACCCTGG - Intergenic
1101230397 12:102735236-102735258 CATGAGAATCACTTGTACCCAGG + Intergenic
1101835260 12:108290691-108290713 CATGCCAGGCACCTGTATCCAGG + Exonic
1102379117 12:112448301-112448323 CATGAAAATCACTTGAACCCAGG - Intronic
1104014942 12:124955604-124955626 CTTCAAAAGCAGCTTTAGCCGGG - Intronic
1104015901 12:124962045-124962067 CAAAAAAAACACCTGAAGCCAGG + Intronic
1106012019 13:25833743-25833765 CATGAAAAGTACATGTTTCCAGG - Intronic
1106860129 13:33896617-33896639 CATGAAAATCACCTGAACTCAGG + Intronic
1108247868 13:48535346-48535368 CATGAGAATCACCTGAACCCGGG - Intergenic
1108816915 13:54304194-54304216 CATGAGAAGCACTTGAACCCGGG - Intergenic
1109525678 13:63571722-63571744 CATGAGAAGCACTTGAACCCAGG - Intergenic
1110466788 13:75811339-75811361 TAAGAAAAGCACCGGTAGGCAGG - Intronic
1111044350 13:82795588-82795610 CATGAAAATCACTTGAACCCGGG - Intergenic
1111508496 13:89228291-89228313 CATGAAAATCACTTGAACCCTGG + Intergenic
1111942072 13:94620415-94620437 TATCAAAACCACCTGTATCCAGG - Intronic
1112132399 13:96538534-96538556 CATGAGAATCACCTGAACCCAGG - Intronic
1112259543 13:97865384-97865406 CAGGAAAAGCACTTGAGGCCAGG - Intergenic
1112846541 13:103649905-103649927 CATGAAAAACACATGTATCTTGG - Intergenic
1114337543 14:21707559-21707581 CATGAGAATCACCTGAACCCAGG - Intergenic
1114497756 14:23145432-23145454 CAGGAAAATCACTTGTACCCGGG + Intronic
1115705317 14:35992524-35992546 CATGAGAAGTACCTGTATCCAGG - Intergenic
1117148629 14:52862155-52862177 CAGGAGAATCACCTGTACCCGGG - Intronic
1117615616 14:57531039-57531061 CATCAAAATCAGATGTAGCCAGG - Intergenic
1118173125 14:63409312-63409334 CATGAAAATCACTTGAACCCGGG + Intronic
1118611071 14:67540531-67540553 CATGAGAATCACTTGAAGCCAGG + Intronic
1118709692 14:68509127-68509149 CTTGAAAACCACCTTTATCCAGG - Intronic
1119294968 14:73525654-73525676 CAAGGAAAGCACCTTTAGGCCGG + Intronic
1119420148 14:74503469-74503491 CATGAACAGCACCAGCAGCACGG - Exonic
1119631949 14:76240150-76240172 CATGAAAATCACTTGAATCCAGG - Intronic
1119674359 14:76542755-76542777 CAGGAAGAGCACGTGAAGCCAGG + Intergenic
1120806742 14:88759589-88759611 CATGAAGATCACCTGAGGCCAGG + Intronic
1120819707 14:88900691-88900713 CATAAAAATCAACTGCAGCCAGG - Intergenic
1122503417 14:102216838-102216860 CATGAAAATCACTTGAACCCAGG + Intronic
1123686599 15:22802297-22802319 CAGGAAAAGCACTTGAACCCGGG + Intronic
1124685618 15:31779363-31779385 GATAAAAAGCACATGTTGCCTGG - Intronic
1126078756 15:44938317-44938339 CAGGAGAATCACCTGAAGCCGGG + Intergenic
1126528537 15:49686381-49686403 CATGAGAATCACCTGAACCCAGG - Intergenic
1126630814 15:50732879-50732901 CATGAAAATCACTTGAACCCAGG - Intronic
1127473112 15:59308128-59308150 CATGAGAATCACCTGAACCCAGG + Intronic
1127543587 15:59967747-59967769 CATGAGAAGCACTTGAACCCAGG + Intergenic
1127776114 15:62265487-62265509 CATGACAATCACTTGTACCCAGG + Intergenic
1128045823 15:64616899-64616921 CATGAGAATCACCTGAACCCGGG - Intronic
1128169862 15:65501980-65502002 CATGAGAATCACCTGAATCCAGG - Intronic
1128419119 15:67474791-67474813 CTTCAAAAGCCACTGTAGCCAGG + Intronic
1128603390 15:69016274-69016296 CATGGAGAGAACCTGTAGCTGGG - Intronic
1129020094 15:72509081-72509103 CATGAGAATCACCTGAACCCAGG - Intronic
1130245192 15:82240955-82240977 CATGAAAATCACTTGAACCCAGG + Intronic
1131074198 15:89484685-89484707 CATGAGAATCACTTGTACCCAGG + Intronic
1131370618 15:91878176-91878198 CAGGAGAAGCACCTGAACCCGGG - Intronic
1132047370 15:98575899-98575921 CATGAGAATCACCTGAACCCTGG + Intergenic
1132501211 16:285495-285517 CACGAACAGCACCTGTGGCAGGG - Exonic
1133194632 16:4160239-4160261 CATGAGAATCACTTGAAGCCAGG - Intergenic
1133359591 16:5163780-5163802 CATGAAAATCACTTGAACCCAGG - Intergenic
1134284079 16:12845033-12845055 CATGAAAATCACCTGAACCCGGG - Intergenic
1134597672 16:15509032-15509054 CAAGCTAAGCACCTGGAGCCTGG + Intronic
1134627045 16:15729641-15729663 CATGAAAATCACTTGAACCCAGG - Intronic
1135003150 16:18794042-18794064 CATGAGAATCACCTGAACCCAGG - Intronic
1135405887 16:22197471-22197493 CAGGAGAAGCACCTGAACCCAGG + Intergenic
1136000572 16:27289492-27289514 CATGAAAATCACTTGAACCCAGG - Intronic
1136016784 16:27405746-27405768 CATGAAAAGTCCCTTTGGCCTGG - Intronic
1136358693 16:29763586-29763608 CAAGAAAAGCACCAGCAGGCTGG + Intergenic
1137846229 16:51690891-51690913 CATGAAAATCACGTGAATCCAGG + Intergenic
1138834039 16:60411501-60411523 CATGAGAATCACCTGAACCCGGG + Intergenic
1139396346 16:66642621-66642643 CATGAAAATCACTTGAACCCTGG + Intronic
1139409463 16:66747660-66747682 CATGAAAATCACTTGAACCCAGG - Intronic
1139509396 16:67418121-67418143 CAGGAAAATCACTTGAAGCCAGG + Intergenic
1139727474 16:68912985-68913007 CATGAAAAACACTTGAACCCGGG + Intronic
1140159987 16:72479732-72479754 CAGGAAAATCACTTGAAGCCAGG + Intergenic
1140284274 16:73586294-73586316 CATGAAAATCACTTGAAACCAGG + Intergenic
1140519779 16:75571216-75571238 CAGGAGGATCACCTGTAGCCAGG - Intronic
1142991940 17:3737198-3737220 CAGGAGAAGCACTTGAAGCCGGG + Intronic
1143547723 17:7608523-7608545 CATGAAAATCACTTGAAGCCAGG + Intronic
1143829618 17:9640734-9640756 CATGAGAATCACTTGTACCCAGG - Intronic
1145103193 17:20093821-20093843 CATGAAAATCACTTGAACCCGGG - Intronic
1145218204 17:21068037-21068059 CAGGAGAAGCACCTGAACCCGGG + Intergenic
1145405945 17:22594074-22594096 CATGAAAATCACCCTTAGGCAGG - Intergenic
1146300873 17:31688391-31688413 CATGAAAATCACTTGAACCCAGG - Intergenic
1146338169 17:31992998-31993020 CTTAAAAAGCACCTCTGGCCGGG - Intronic
1146763355 17:35496968-35496990 CATCAAAAGCCACTGTAGGCTGG + Intronic
1147030844 17:37634536-37634558 CAGGAGAATCACCTGAAGCCAGG + Intronic
1147392302 17:40117582-40117604 CATGAGGATCACCTGAAGCCAGG - Intergenic
1148260302 17:46176596-46176618 CATGAGAATCACCTGAACCCAGG + Intronic
1148274602 17:46292237-46292259 CATGAAAACCACTTGAACCCAGG + Intronic
1148293127 17:46474140-46474162 CAGGAAAATCACCTGAACCCAGG - Intergenic
1148315312 17:46691843-46691865 CAGGAAAATCACCTGAACCCAGG - Intronic
1148617041 17:49008688-49008710 CATGGTTAGCAACTGTAGCCTGG + Intronic
1148781927 17:50127304-50127326 CATCAAAACCACCTCTAGGCTGG + Intronic
1148888975 17:50794049-50794071 CATGAAAATCACTTGAACCCAGG + Intergenic
1149250016 17:54757272-54757294 CAGGAGAATCACCTGAAGCCAGG + Intergenic
1149413783 17:56436735-56436757 CAGGAAAATCACTTGTACCCGGG + Intronic
1149878608 17:60264765-60264787 CAAGAAAATCACTTGAAGCCGGG + Intronic
1149927252 17:60713924-60713946 CATGAAAATCACTTGAACCCAGG - Intronic
1150111383 17:62503508-62503530 CATGAGAATCACCTGAACCCGGG - Intronic
1150405881 17:64900126-64900148 CATGAAAACCACTTGAACCCAGG - Intronic
1150816248 17:68394372-68394394 CAGGAGAATCACCTGAAGCCAGG + Intronic
1150823098 17:68451339-68451361 CATGAGAATCACCTGAACCCAGG + Intronic
1150922062 17:69494403-69494425 CATGAAAATCGCTTGTACCCAGG + Intronic
1150988764 17:70230579-70230601 CATGAGAATCACTTGAAGCCAGG - Intergenic
1151584541 17:75001139-75001161 CATGAAAATCACTTGAACCCAGG + Intronic
1151637242 17:75358789-75358811 CATGAGAATCACCTGAACCCAGG + Intronic
1151979344 17:77499397-77499419 CATCAGCAGCACCTGCAGCCCGG - Exonic
1152428684 17:80234940-80234962 CAGGAAAACCACTTGAAGCCGGG - Intronic
1153655157 18:7275472-7275494 TATGCAAAGCACCTGTAGCAAGG - Intergenic
1154132435 18:11749031-11749053 CATGAGAAGCCCCTGAAGCTGGG + Intronic
1154507576 18:15058158-15058180 CATGAAAATCACTTGAACCCGGG - Intergenic
1155014814 18:21823139-21823161 CATGAGAATCACCTGAACCCAGG + Intronic
1155267713 18:24109911-24109933 CATGAAAATCACTTGAACCCGGG + Intronic
1155303409 18:24454955-24454977 CATGAGAATCACTTGAAGCCAGG - Intergenic
1157468076 18:47965730-47965752 CATGAGAATCACTTGAAGCCGGG - Intergenic
1158605423 18:58891435-58891457 CATGAGAATCACCTGAACCCAGG + Intronic
1159304652 18:66625448-66625470 TATAAAAAGCACATGTAGGCTGG + Intergenic
1159507681 18:69357722-69357744 CATGAAAATCACTTGAACCCAGG - Intergenic
1160136035 18:76272626-76272648 CATGAAAATCACTTGAACCCAGG + Intergenic
1160737190 19:668441-668463 CATGAAAATCACTTGAACCCGGG + Intergenic
1160803637 19:981689-981711 CAGGAAAACCACTTGAAGCCAGG + Intergenic
1161424235 19:4193742-4193764 CATGAGAATCACTTGAAGCCGGG + Intronic
1161943001 19:7417602-7417624 CATGACAATCACCTGAAACCAGG + Intronic
1162156297 19:8680101-8680123 CATGAAAATCACTTGAACCCAGG + Intergenic
1162324769 19:9992682-9992704 CATGAGAATCACCTGAACCCAGG + Intronic
1162723049 19:12673790-12673812 CATGAGAATCACCTGAACCCTGG - Intronic
1163331099 19:16638394-16638416 CAGGAAAATCACCTGAACCCGGG - Intronic
1163411953 19:17160598-17160620 CATGAAAATCACTTGAACCCAGG - Intronic
1163486328 19:17588797-17588819 CAGGAAAATCACCTGAAGTCAGG - Intergenic
1163925968 19:20343959-20343981 CATGACATGCCCCTTTAGCCTGG + Intergenic
1164119196 19:22250509-22250531 CATGAGAATCACCTGAACCCGGG - Intergenic
1164296743 19:23917041-23917063 CATGACAATCACCTGAAGTCAGG - Intronic
1165040021 19:33062472-33062494 AAAAAAAAACACCTGTAGCCGGG + Intronic
1165480691 19:36062037-36062059 CATGAGAATCACCTGAACCCGGG - Intronic
1166337865 19:42119578-42119600 CAAGAGAATCACCTGAAGCCGGG + Intronic
1166660322 19:44643107-44643129 CAGGAAAATCACTTGTACCCGGG - Intergenic
1167230494 19:48279888-48279910 CAGGTAAAGCACATGGAGCCAGG + Intronic
1167328625 19:48840320-48840342 CATGAAAATCACTTGAACCCAGG + Intronic
927635279 2:24811034-24811056 CATGAGAATCACTTGAAGCCAGG - Intronic
929134563 2:38611063-38611085 CATGAAAATCACTTGAACCCAGG - Intergenic
929450532 2:42033953-42033975 CAGGAAAATCACCTGAACCCAGG + Intergenic
929494778 2:42431011-42431033 CATGAAAATCACTTGAACCCAGG + Intergenic
929636052 2:43521645-43521667 CCTGAATAGCAGCTATAGCCTGG - Intronic
929677977 2:43956795-43956817 CAGGAAAATCACCTGAACCCAGG + Intronic
930513370 2:52374472-52374494 CATGAGAATCACCTGGACCCGGG + Intergenic
930656208 2:54009479-54009501 CAAGAGAAGCACTTGTACCCAGG + Intronic
930796116 2:55393381-55393403 CATGAGAATCACCTGAACCCTGG - Intronic
931123874 2:59252081-59252103 CATGAGAATCACCTGAACCCAGG + Intergenic
931569541 2:63653815-63653837 CACGAGAATCACCTGAAGCCAGG + Intronic
931707143 2:64956400-64956422 CATGAAAATCACTTGAACCCAGG - Intergenic
931995106 2:67832062-67832084 CATGAAAATCACTTGAACCCAGG + Intergenic
932016005 2:68026918-68026940 CATGAGAATCACCTGAACCCGGG + Intergenic
932154273 2:69401984-69402006 CAGGAGAATCACCTGTACCCGGG - Intronic
932417604 2:71583321-71583343 CCTGAAGAGCACCTGTGGCAGGG - Intronic
932587613 2:73041595-73041617 CAGGAAAATCACCTGAACCCAGG + Intronic
932946415 2:76237850-76237872 CAGGAGAATCACCTGAAGCCGGG - Intergenic
933697449 2:85230424-85230446 CATGAAAATCACTTGAACCCAGG - Intronic
933773665 2:85759070-85759092 CATGCCAAGCACCTGGGGCCCGG + Intronic
935125648 2:100220221-100220243 CATGAAAATCACTTGAACCCAGG - Intergenic
935290166 2:101603423-101603445 CAGGAAAATCACCTGAACCCAGG + Intergenic
937403067 2:121602080-121602102 CATGAAAATCACTTGAACCCAGG + Intronic
938511278 2:131947899-131947921 CAAGAAAAGTATCTGTAACCTGG + Intergenic
939227427 2:139381814-139381836 ACTCAATAGCACCTGTAGCCAGG + Intergenic
940960638 2:159781968-159781990 AATAAAAAGCACCTTTAGGCTGG + Intronic
942087793 2:172459409-172459431 CATGAGAAGCACTTGAACCCGGG + Intronic
943556072 2:189405322-189405344 CATGAGAATCACTTGAAGCCAGG - Intergenic
943625251 2:190191233-190191255 CATGAGAATCACCTGAATCCAGG - Intronic
943974259 2:194450501-194450523 CAGGAAAATCACTTGTATCCGGG + Intergenic
944102236 2:196039704-196039726 CATGAGAAGCACTTGAACCCAGG + Intronic
946425777 2:219595580-219595602 CATGGGTAGCCCCTGTAGCCAGG - Intergenic
947684299 2:232068907-232068929 CATGAGAATCACCTGAACCCGGG - Intronic
948186087 2:236022625-236022647 CATGAAAATCACTTGAACCCTGG - Intronic
948903276 2:240966616-240966638 GCTGAAAAGCCCCTGGAGCCAGG + Intronic
1170674066 20:18462843-18462865 CATGAAAATCACCTGAACCCAGG + Intronic
1172005127 20:31814158-31814180 CATGAAAATCACTTGAACCCAGG - Intergenic
1172008907 20:31835110-31835132 CATGAGAATCACCTGAAGCCGGG - Intergenic
1172031323 20:31984166-31984188 CACGAAAATCACCTGAACCCGGG + Intronic
1172138845 20:32707410-32707432 CATGAAAATCACTTGAACCCAGG - Intronic
1172414332 20:34751948-34751970 CATGAAAATCACTTGAACCCAGG - Intronic
1172640619 20:36438279-36438301 CATGAAAATCACTTGAACCCAGG + Intronic
1172814706 20:37677155-37677177 CATGAAAAGGGCCTGCAGGCTGG - Intergenic
1173162241 20:40661677-40661699 CATGAAAATCATATGCAGCCTGG - Intergenic
1174322374 20:49752012-49752034 CATGAAAATCACTTGAACCCAGG - Intergenic
1174799037 20:53547520-53547542 CTTGAAAAGCAGATGAAGCCAGG - Intergenic
1176790503 21:13313623-13313645 CATGAAAATCACTTGAACCCAGG + Intergenic
1177648579 21:23931842-23931864 CATGAAAATCACTTGAACCCAGG + Intergenic
1179156082 21:38852242-38852264 CATGAAAATCACTTGAACCCGGG + Intergenic
1180288003 22:10769069-10769091 CATGAACATCACCTGAACCCAGG + Intergenic
1181503377 22:23333188-23333210 CATGAAAATCACTTGAAACCAGG - Intergenic
1181708371 22:24663418-24663440 CATGAAAATCACTTGAACCCAGG - Intergenic
1181723569 22:24795044-24795066 CATGAGAATCACTTGAAGCCAGG + Intergenic
1183129565 22:35821299-35821321 GATTAAAAGCAGCAGTAGCCTGG + Intronic
1183168936 22:36170245-36170267 TATGAAGAACACCTGTAACCTGG - Intergenic
1183578971 22:38711748-38711770 CATGAGAATCACCTGAACCCCGG + Intronic
1184364921 22:44044576-44044598 CATGAAAATCACTTGAACCCGGG - Intronic
1184469716 22:44689578-44689600 CATGGAAGTCACCTGTGGCCTGG + Intronic
950249343 3:11451302-11451324 CATGAGAATCACTTGTACCCAGG - Intronic
952166004 3:30749706-30749728 CCTGAGAAGCACCTGAAGGCAGG + Intronic
952728403 3:36613783-36613805 TATGAAAAGAACCTGAGGCCTGG - Intergenic
952774912 3:37035914-37035936 CATGAGAATCACCTGAACCCAGG + Intronic
952972619 3:38662210-38662232 CATGAAAATCACTTGAACCCAGG - Intergenic
953445903 3:42966423-42966445 CATGAAAATCACTTGAACCCAGG - Intronic
954559690 3:51546295-51546317 CATGAAAAGTAACTGTAGTTAGG + Intronic
955052330 3:55424637-55424659 CAGGAAAAGCACTTGAACCCGGG + Intergenic
955318404 3:57957646-57957668 CAAGAAAATCACCTGAACCCAGG + Intergenic
956122935 3:65984199-65984221 CAGGAAAATCACTTGAAGCCAGG + Intronic
956362264 3:68461187-68461209 CATGAAAATCACTTGAACCCAGG + Intronic
956724432 3:72145571-72145593 CATGAACAGCACATGCAGACTGG + Intergenic
956744050 3:72297542-72297564 CATGAGAAGCACTTGAACCCAGG + Intergenic
956766029 3:72485280-72485302 CATGAAAATCACTTGAACCCAGG + Intergenic
956875745 3:73461247-73461269 CCTGAAAAGAACCATTAGCCAGG + Intronic
958907599 3:99959240-99959262 CATGAGAATCACTTGTAACCTGG - Intronic
959763167 3:109993120-109993142 CATGAAAATCACTTGAACCCGGG - Intergenic
960168884 3:114435542-114435564 CATGAAAAGCACATGAAGTCTGG - Intronic
961288513 3:125826112-125826134 CATGAAAATCACTTGAACCCAGG + Intergenic
961361512 3:126370966-126370988 TATGAACTGCATCTGTAGCCAGG - Intergenic
961709640 3:128818139-128818161 CATGAAAAGCACCAGTGTACTGG - Intergenic
961898542 3:130189938-130189960 CATGAAAATCACTTGAATCCAGG - Intergenic
962725712 3:138224656-138224678 CATGAAAATCACTTGAACCCAGG + Intronic
963937816 3:151072793-151072815 CATGAGAAGCACTTGAACCCGGG - Intergenic
964096904 3:152942456-152942478 CATAAAAAGCACCTGGGGCCTGG + Intergenic
966080561 3:175994997-175995019 CATGAGAATCACCTGAACCCAGG - Intergenic
966180225 3:177181385-177181407 CATGAGAATCACCTGAACCCGGG + Intronic
966183255 3:177205473-177205495 CAGGAGAATCACCTGAAGCCGGG + Intergenic
966392709 3:179469183-179469205 CATGAAACCAAGCTGTAGCCTGG + Intergenic
966872037 3:184297039-184297061 CAGGAAAATCACCTGAACCCGGG + Intronic
967473229 3:189887114-189887136 CATGAAAATCACTTGAACCCGGG + Intronic
967820486 3:193834901-193834923 CATTAAAAGCACCAGGAGCAAGG + Intergenic
968018482 3:195361341-195361363 CATGAAAATCACTTGAACCCAGG + Intronic
968783339 4:2599990-2600012 CATGAGAATCACCTGAACCCAGG - Intronic
969009530 4:4050440-4050462 CATGAAAATCACTTGAACCCAGG - Intergenic
969744822 4:9061871-9061893 CATGAAAATCACTTGAACCCAGG + Intergenic
969828974 4:9780516-9780538 CACCAAACGCACCTGTACCCTGG - Intronic
970030631 4:11670105-11670127 CAGGAAAATCACCTGAAGCTAGG - Intergenic
970690688 4:18616947-18616969 CAGGAGAATCACCTGAAGCCAGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
971766329 4:30836686-30836708 TATGATAAAAACCTGTAGCCTGG + Intronic
971997604 4:33985439-33985461 CATGAAAATCACCCTTAGGCGGG + Intergenic
972253006 4:37324772-37324794 CCTGAAATGCAGCTGCAGCCTGG - Intronic
972521823 4:39865616-39865638 CATGAAAATCACTTGAACCCAGG - Intronic
973876190 4:55221822-55221844 CATAAAAATCATCTGTAGGCCGG + Intergenic
976214801 4:82705982-82706004 CATGAAAACCACATGTATTCAGG - Intronic
976402686 4:84624951-84624973 CATGAGAATCACCTGAACCCAGG - Intronic
976403644 4:84636819-84636841 CATGAAAAGCTCTTTTAGGCCGG - Intronic
977303553 4:95295995-95296017 CAGGAAAATCACCTGAACCCAGG + Intronic
978069437 4:104448467-104448489 CAGGAAAATCACCTGAACCCAGG + Intergenic
978676866 4:111328414-111328436 CATGAAAATCACTTGAACCCAGG + Intergenic
981481725 4:145245406-145245428 CATGAAAATCACTTGAACCCAGG + Intergenic
981691289 4:147512589-147512611 CATGAAAAGCACTTACAGCAGGG - Intronic
981922311 4:150098786-150098808 CAGGAAAATCACCTGAACCCAGG - Intronic
981927694 4:150157603-150157625 CATGAGAATCACCTGAACCCGGG - Intronic
981968344 4:150634020-150634042 CAGGAAAATCACCTGAAACCAGG + Intronic
981977010 4:150743058-150743080 CATGATAATCACTTGTACCCAGG - Intronic
982503414 4:156188467-156188489 CATGAGAATCACCTGAACCCAGG + Intergenic
982700407 4:158654859-158654881 CAGGAAAATCACCTGAACCCTGG - Intergenic
983638199 4:169919461-169919483 CATGAAATTGACCTATAGCCTGG + Intergenic
983878415 4:172904381-172904403 CAGGAAAAGCGTCTGTAGCAGGG + Intronic
985140780 4:186838976-186838998 CATGAAAAGCACCTAGAACAGGG + Intergenic
986562964 5:9081953-9081975 CAGGAAAAGCATCTGTTGTCAGG + Intronic
987904667 5:24060448-24060470 CATAAAAAGAACCTGGGGCCGGG + Intronic
989539181 5:42598953-42598975 TATGAAAAGCATCTATAGGCTGG + Intronic
990098094 5:52144402-52144424 CATGAAAATCACTTGAATCCTGG + Intergenic
990383748 5:55239415-55239437 CATGAGAATCACTTGTACCCAGG + Intergenic
990454391 5:55970812-55970834 CATGAGAATCACCTGAACCCAGG + Intronic
990515322 5:56526116-56526138 CATGAAAAACACTTGTAACGTGG + Intronic
991282556 5:64932599-64932621 CATGAAAACCTCCTATAGCTGGG - Intronic
991569677 5:68041096-68041118 TATAAAAAGTACCTGTGGCCTGG + Intergenic
991656176 5:68905797-68905819 CACGAAAATCACCTTTATCCTGG - Intergenic
992643643 5:78792284-78792306 CATGAGAAGCACTTGAACCCAGG + Intronic
993970360 5:94412491-94412513 CATGAGAAGCACTTGAACCCAGG - Intronic
996088049 5:119324180-119324202 CAGGAAAATCACCTGAACCCAGG + Intronic
996841685 5:127853474-127853496 CATCAAAAGCACCTGGAGGCTGG + Intergenic
997231520 5:132247744-132247766 CATGAAAATCACCTGAACTCGGG + Intronic
997436923 5:133882284-133882306 GATGAACAGAACCTGAAGCCTGG + Intergenic
997501704 5:134380204-134380226 CATTAAAAATAACTGTAGCCAGG - Intronic
998402372 5:141854389-141854411 CATGACAGGCACATGTACCCGGG - Exonic
999743772 5:154576499-154576521 CAGGAAAAGCAGCTGTCCCCTGG - Intergenic
999849908 5:155526728-155526750 AAAGAAAAGCACCTGTGGCCGGG - Intergenic
999974825 5:156901187-156901209 CATGAGAATCACCTGAACCCAGG + Intergenic
1000010214 5:157224189-157224211 CATGAAAATCACTTGAACCCAGG + Intronic
1000378723 5:160609469-160609491 CATGAAAATCACTTGAACCCAGG - Intronic
1000793312 5:165633396-165633418 CAGGAAATGAACCTGTAACCAGG + Intergenic
1000928807 5:167228119-167228141 CATGAGAATCACTTGAAGCCAGG - Intergenic
1001281997 5:170392729-170392751 CATGAAAATCACTTGAATCCAGG + Intronic
1001494407 5:172177919-172177941 CAGGAAAATCACCTGAAACCTGG - Intronic
1003362429 6:5441012-5441034 CAGGAGAATCACCTGAAGCCGGG - Intronic
1004200506 6:13543323-13543345 CATGAAAATCACCTGAACCCGGG + Intergenic
1006321060 6:33319788-33319810 AATGAAAAGAACCTGGAACCTGG - Exonic
1006490351 6:34381978-34382000 CAGGAAAATCACCTGAACCCGGG + Intronic
1006722698 6:36168820-36168842 CAGGAAAATCACCTGAGGCCAGG - Intergenic
1006759994 6:36451901-36451923 CATGAAAAGCACTTGAACCGGGG - Intronic
1011441495 6:87391825-87391847 CAGGAGAATCACCTGAAGCCGGG - Exonic
1013102119 6:106995893-106995915 CATGAAGAACACCTGGACCCTGG + Intergenic
1013265119 6:108488773-108488795 CATGAGAATCACTTGTACCCAGG + Intronic
1013351380 6:109309018-109309040 CATGAGAATCACCTGAACCCAGG + Intergenic
1013564195 6:111341137-111341159 CATGAAAATCACTTGAACCCGGG - Intronic
1016423171 6:143906534-143906556 CAGGAGAATCACCTGAAGCCAGG - Intronic
1017825584 6:158079463-158079485 CATGAAAATCACTTATACCCTGG - Intronic
1019656609 7:2199420-2199442 CATGAAGGGCGCCTGCAGCCTGG + Intronic
1020036273 7:4964999-4965021 CATCAACAGCACCTGTAGGCAGG + Intergenic
1020184544 7:5948946-5948968 CATGAGAATCACCTGAACCCAGG - Intronic
1020298372 7:6775798-6775820 CATGAGAATCACCTGAACCCAGG + Intronic
1020341952 7:7121352-7121374 CAGGAAAAGCACTTGAATCCGGG - Intergenic
1020653091 7:10898409-10898431 CATGAGAATCACTTGAAGCCAGG + Intergenic
1020933217 7:14426965-14426987 CATGAAAATCACCTGAACCCAGG + Intronic
1021090593 7:16478344-16478366 CATGAGAATCACCTGAACCCAGG - Intronic
1022721664 7:32946978-32947000 CATGAGAATCACTTGAAGCCAGG - Intergenic
1026482433 7:70790315-70790337 CATGAACAGCATCAGCAGCCTGG + Exonic
1028919498 7:96295254-96295276 CCTGAAAATCACCTGAACCCGGG + Intronic
1029068491 7:97875947-97875969 CATGAAAATCACTTGAACCCAGG - Intergenic
1029450229 7:100637499-100637521 CACAAAAATCACCTGAAGCCGGG + Intronic
1030209692 7:106984109-106984131 CATGAGAATCACTTGTACCCAGG - Intergenic
1031052663 7:116960280-116960302 CATGAGAATCACCTGAACCCAGG - Intronic
1031137230 7:117898269-117898291 CATGAAAAGCATTTGCAGGCTGG + Intergenic
1031424701 7:121591212-121591234 CATAAAAAGCACCCGGAGGCAGG - Intergenic
1032040584 7:128557410-128557432 CATGAGAATCACCTGAACCCGGG - Intergenic
1033491571 7:141848594-141848616 CAGGAAAAGAGTCTGTAGCCTGG + Intergenic
1034317808 7:150150001-150150023 AATGAAATGCACCTGCTGCCTGG + Intergenic
1034442331 7:151092260-151092282 CTTGGAAAGCAGGTGTAGCCTGG + Intronic
1034774944 7:153817251-153817273 AATGAAATGCACCTGCTGCCTGG - Intergenic
1034863924 7:154624397-154624419 CAGGAAAATCACTTGTACCCAGG + Intronic
1035186017 7:157126202-157126224 CCGGAAAAGCACCTGAAGCAAGG + Intergenic
1036250809 8:7161131-7161153 CATGAAAATCACTTGAACCCAGG - Intergenic
1036366681 8:8126328-8126350 CATGAAAATCACTTGAACCCAGG + Intergenic
1036403032 8:8427236-8427258 CATGAAAATCACTTGAAGCCGGG + Intergenic
1036620293 8:10420681-10420703 CATGAAAAGCACTTGTACATGGG - Intronic
1038123171 8:24641330-24641352 CAGGAAAATCACTTGAAGCCGGG + Intergenic
1038984166 8:32790708-32790730 CAGGAAAATCACTTGAAGCCAGG - Intergenic
1039519663 8:38159449-38159471 CCTGAAAATCACCTGTGCCCTGG - Intergenic
1039788154 8:40851987-40852009 CATGAAAATCACTTGAACCCTGG - Intronic
1042252326 8:66769314-66769336 CATGAGAATCACCTGAACCCAGG - Intronic
1043332459 8:79134139-79134161 CATGAGAATCACTTGAAGCCAGG + Intergenic
1043348290 8:79326052-79326074 CATGAAAATCACTTGAACCCAGG + Intergenic
1044482657 8:92710714-92710736 CATGAAAATCACTTGAACCCAGG + Intergenic
1044706338 8:95012511-95012533 CATTAAAAGTACCTTTAGGCTGG + Intronic
1045290934 8:100832112-100832134 CATGAAAATCACTTGAACCCGGG - Intergenic
1045973176 8:108102647-108102669 CATGAAAAGAAGCTGGAGGCTGG + Intergenic
1047313738 8:123713784-123713806 CATGAAAATCACTTGAACCCAGG - Intronic
1047730116 8:127720852-127720874 CAGGAAAATCACCTGAACCCAGG + Intergenic
1048382458 8:133878951-133878973 CAGGCAGAGCACCTGTGGCCAGG - Intergenic
1049998302 9:1051412-1051434 CAGGAAAGGCACGTGTGGCCTGG + Intronic
1050110069 9:2206260-2206282 CATGAGAATCACTTGTACCCAGG - Intergenic
1050172909 9:2841473-2841495 CAGGAAAATCACCTGAACCCAGG + Intronic
1050501915 9:6307622-6307644 AATGCAAAGCAGCTGCAGCCAGG + Intergenic
1050518213 9:6468329-6468351 CATGGAAAGCACCTGTTTGCAGG + Intronic
1051020126 9:12533513-12533535 CATGAAAATCACTTGAACCCAGG + Intergenic
1051804722 9:20979429-20979451 CATGAAAATCACTTGAACCCAGG - Intronic
1052797100 9:32932839-32932861 CATGGAAATTACCTGTACCCTGG - Intergenic
1053527077 9:38841145-38841167 CTTGAAACCCACCTGCAGCCTGG - Intergenic
1054199300 9:62065576-62065598 CTTGAAACCCACCTGCAGCCTGG - Intergenic
1054639053 9:67522781-67522803 CTTGAAACCCACCTGCAGCCTGG + Intergenic
1054706585 9:68469008-68469030 CATGAGAATCACCTGAACCCAGG - Intronic
1055098378 9:72437847-72437869 CATGAAAATCACTTGAACCCAGG - Intergenic
1055310193 9:74971172-74971194 CAGGAGAATCACCTGAAGCCGGG + Intergenic
1055493123 9:76826378-76826400 CATGAGAATCACCTGAACCCGGG + Intronic
1056127229 9:83546262-83546284 CATGAAAATCACTTGAACCCAGG + Intergenic
1056562332 9:87742355-87742377 CAAGAAAAGCAGCTGCAGCAAGG + Intergenic
1057195560 9:93114206-93114228 CATTAAAGGCATCTGTAGCAAGG - Intergenic
1057590679 9:96370562-96370584 CATGAGAATCACCTGAACCCAGG + Intronic
1057742996 9:97728441-97728463 CATGAAAGACACCTGGAGCTGGG + Intergenic
1058437018 9:104972185-104972207 CATGAGAATCACCTGAACCCGGG + Intergenic
1058875405 9:109239819-109239841 CAGGAAGAGCACAAGTAGCCAGG + Intronic
1058961927 9:109999654-109999676 CACGCAAAGCACCTGTGGGCAGG - Intronic
1059097546 9:111434989-111435011 CATGAAAATCACTTGAACCCAGG - Intronic
1059148952 9:111929909-111929931 CATGAGAATCACCTGAACCCGGG - Intronic
1059156659 9:111995377-111995399 CAGGAAAATCACCTGAACCCGGG + Intergenic
1059440402 9:114303533-114303555 CATGAAAAGCACCTGTAGCCCGG - Intronic
1061026258 9:128051739-128051761 CATCAAGATCACCTGAAGCCAGG + Intergenic
1061064799 9:128270954-128270976 CATGAAAATCACTTGAACCCGGG + Intronic
1061146465 9:128802146-128802168 CAGGAGAAGCACCTGAACCCAGG - Intronic
1061217237 9:129228653-129228675 CATGAAAACCATCTCTAGGCTGG - Intergenic
1061400903 9:130367847-130367869 CATGAGAATCACCTGAACCCAGG + Intronic
1061857786 9:133452203-133452225 CATGAAAATCACTTGAACCCAGG - Intronic
1062594193 9:137290523-137290545 CAGGAAAATCACTTGAAGCCAGG - Intergenic
1185969267 X:4643730-4643752 CAGGAAAAGCACTTGAACCCAGG + Intergenic
1186430017 X:9497314-9497336 CAGGAAAATCACCTGAACCCAGG + Intronic
1186835944 X:13437888-13437910 AATGAAAGGCACATATAGCCTGG - Intergenic
1187921708 X:24209666-24209688 CAGGAGAACCACCTGTACCCAGG - Intronic
1188906209 X:35794956-35794978 CAGGAAAATCACCTGAACCCGGG - Intergenic
1189274449 X:39775337-39775359 CATGAGAATCCCCTGTACCCAGG + Intergenic
1189358502 X:40329538-40329560 CATGAGAATCACCTGAACCCAGG + Intergenic
1189428114 X:40920683-40920705 CATGAGAATCACTTGAAGCCGGG - Intergenic
1190828497 X:54040302-54040324 CATGAAAAAAAGCTGTTGCCTGG - Intronic
1190959742 X:55234542-55234564 GGTGCAAAGCCCCTGTAGCCAGG - Intronic
1191752197 X:64555097-64555119 CATGAAAATCACTTGAACCCAGG + Intergenic
1191890934 X:65939897-65939919 CATGAAAATCACTTGAACCCAGG - Intergenic
1192230499 X:69261334-69261356 TATGAAAAGCACTTGGGGCCGGG + Intergenic
1193234408 X:79089274-79089296 CAGGAAAATCACCTGAACCCAGG - Intergenic
1193265039 X:79457769-79457791 CATGAAAATCACTTGAATCCAGG - Intergenic
1196233828 X:113255912-113255934 TAAGAAAAGTAGCTGTAGCCAGG - Intergenic
1196768031 X:119267411-119267433 CATGAGAATCACCTGAACCCGGG - Intergenic
1196915565 X:120531550-120531572 CATGAGAATCACCTGAACCCGGG - Intronic
1197235413 X:124056987-124057009 CATGAGAAGCACCTGAACCCAGG - Intronic
1198101306 X:133424471-133424493 CATGAGAATCACCTGAACCCAGG - Intergenic
1198283725 X:135170097-135170119 CATGAGAACCACCTGAACCCAGG - Intronic
1199425259 X:147693410-147693432 CATGAAAAACACCTGTCCCATGG - Intergenic
1199597560 X:149519053-149519075 CATGATAATCACCTGAAACCAGG + Intronic
1199758044 X:150883075-150883097 CAGGAAAATCACTTGAAGCCGGG + Intronic
1200054897 X:153455237-153455259 CAGGAACAGCACCTGGAGGCTGG + Intronic
1200783254 Y:7236026-7236048 CAGGAAAATCACCTGAACCCAGG - Intergenic
1201609964 Y:15830328-15830350 CAGGAAAATCACCTGAACCCTGG - Intergenic
1201638660 Y:16154403-16154425 CAGGAAAATCACTTGAAGCCTGG + Intergenic
1201894642 Y:18980648-18980670 CATAGAAGGCACCTGTGGCCGGG + Intergenic