ID: 1059440935

View in Genome Browser
Species Human (GRCh38)
Location 9:114306459-114306481
Sequence CTTGAACCCCAGGCTGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059440923_1059440935 19 Left 1059440923 9:114306417-114306439 CCGAGATACCTCCCAGGTTGTGA 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG 0: 1
1: 0
2: 4
3: 15
4: 227
1059440930_1059440935 7 Left 1059440930 9:114306429-114306451 CCAGGTTGTGAGAACTGGGGGCT 0: 1
1: 0
2: 2
3: 15
4: 162
Right 1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG 0: 1
1: 0
2: 4
3: 15
4: 227
1059440929_1059440935 8 Left 1059440929 9:114306428-114306450 CCCAGGTTGTGAGAACTGGGGGC 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG 0: 1
1: 0
2: 4
3: 15
4: 227
1059440921_1059440935 27 Left 1059440921 9:114306409-114306431 CCGTGGAACCGAGATACCTCCCA 0: 1
1: 0
2: 1
3: 5
4: 105
Right 1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG 0: 1
1: 0
2: 4
3: 15
4: 227
1059440925_1059440935 11 Left 1059440925 9:114306425-114306447 CCTCCCAGGTTGTGAGAACTGGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG 0: 1
1: 0
2: 4
3: 15
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059440935 Original CRISPR CTTGAACCCCAGGCTGGACC AGG Intronic
900619572 1:3580641-3580663 GGTGCCCCCCAGGCTGGACCGGG + Intronic
902252359 1:15162450-15162472 TTTGATCCCCAGGCTGGATGCGG - Intronic
902384022 1:16066175-16066197 CTTGAATCTCAGGCTGGGCGTGG - Intronic
903328848 1:22586664-22586686 CTTGAGCCCAAGACTGGGCCGGG + Intronic
903859549 1:26356578-26356600 CATCACCCCCAGTCTGGACCCGG + Intergenic
905927513 1:41762447-41762469 CTGGATCCGCAGGCTGGAGCAGG + Intronic
908444917 1:64191218-64191240 CTGGAGTTCCAGGCTGGACCTGG + Intergenic
911731321 1:101294935-101294957 CCTGAACTCCAGGCTGGCCGAGG - Intergenic
912437572 1:109672572-109672594 TATGAAACCCAGGCTGGACAAGG - Intronic
914900302 1:151707909-151707931 CTTCACCACCAGGCTGGACGAGG + Exonic
914980333 1:152409710-152409732 AGTGATCCTCAGGCTGGACCAGG - Exonic
915118811 1:153616064-153616086 CCTGAAGCCCAGGCGGGGCCTGG - Intronic
915529405 1:156494641-156494663 CTTCAGCCCCAGCCTGGCCCAGG - Intronic
916245039 1:162678805-162678827 ACTGAACTCCAGGCTGGACTTGG + Intronic
916957359 1:169852901-169852923 ATTGAAAGCCAGGCTGGAGCAGG - Exonic
917355702 1:174124521-174124543 CTTTGAGCCGAGGCTGGACCTGG - Intergenic
920218508 1:204378192-204378214 CTTGAACCACCGGCGGGGCCGGG + Intergenic
921524019 1:216194866-216194888 CCTGTACCACAGGCTGGACCTGG - Intronic
922572405 1:226641936-226641958 CCTGAACCCCAGGGTGGCCGTGG + Exonic
924464337 1:244286414-244286436 CCTGAAGACCAGGCTGTACCAGG + Intergenic
924858232 1:247895991-247896013 CATGAACCCCAGGCTCTGCCGGG + Exonic
1069983122 10:72266104-72266126 CTAGGACCCCAGGCAGAACCAGG + Intergenic
1070777700 10:79119526-79119548 CTTGAACCCTAGGCTCAGCCAGG - Intronic
1070819983 10:79348870-79348892 CCTGAACCCAAGGCTGGAGGAGG - Intronic
1070954734 10:80456160-80456182 CTTAGAACCCAGGCTGGACATGG + Intronic
1072944786 10:99799909-99799931 CCAGAACGCCAGGCTGGACATGG + Intronic
1073710583 10:106033402-106033424 CTTGAGACCCAGGCTGGACCAGG + Intergenic
1076488824 10:130842838-130842860 CTTGAATCCCAGTCTGGGACTGG - Intergenic
1077174330 11:1181746-1181768 CTGGCAGCCCAGGCTGGCCCCGG + Intronic
1077423280 11:2462884-2462906 CCTGAACCCCAGGCTGGGCACGG - Intronic
1078141735 11:8698205-8698227 CAGGAACCCCTGGCTGGTCCTGG - Intronic
1078539055 11:12198869-12198891 CATGAAGCTCAGGCTGGACCTGG + Intronic
1078823671 11:14906664-14906686 CTTCAACCCCAAGCGGAACCCGG + Intronic
1080111665 11:28575040-28575062 ATTGTACCACAGGCTGGACCAGG - Intergenic
1080584374 11:33667968-33667990 CCTGCACCCCAGCCTGGAGCAGG + Exonic
1080614962 11:33937737-33937759 CTCCAAGCCCAGGCTGGAGCAGG - Intergenic
1081261696 11:40969970-40969992 CTTAAAGCCCAGGCTTGAACAGG - Intronic
1081806668 11:45894622-45894644 CTCGAACTGCAGGCTGGAGCAGG - Intronic
1083951659 11:65959904-65959926 CTACAACCCCAGCCTGGACCCGG + Exonic
1084063967 11:66692931-66692953 CTCCACCCCCAGGCTGGGCCGGG + Intronic
1084223070 11:67696801-67696823 CATCAGCCCCAGGCTGCACCTGG + Intergenic
1084618766 11:70254104-70254126 CTTGTCCCCCAGGCTGGAGTGGG + Intergenic
1085392505 11:76189670-76189692 CTTGATGTCCAGGCTGGATCAGG + Intronic
1086474144 11:87152488-87152510 CTTGACGCCCAGGCTGGGCTTGG + Intronic
1089771927 11:120809179-120809201 TTAGAAGCCCAGGCTGGACAGGG - Intronic
1090569277 11:128029566-128029588 CCTGAACTCCTGGCTGGATCTGG + Intergenic
1090840167 11:130480507-130480529 CTTGAAGCCTAGGCTGGGCTGGG + Intergenic
1091675125 12:2483709-2483731 CGTGACCCCCAGCCTGGACGGGG + Intronic
1096569940 12:52516686-52516708 CATGAACACCAAGCTGGCCCTGG - Exonic
1099796670 12:87409160-87409182 CTTTAAGCCTAGGCTGGAGCTGG - Intergenic
1100982279 12:100171127-100171149 CTTCTTCCCCAGGCTGGACTAGG + Intergenic
1102884147 12:116508800-116508822 CCTGGGCCCCAGCCTGGACCCGG - Intergenic
1104460066 12:128948097-128948119 CGTGAAACCCAGGCAGGCCCTGG + Intronic
1104966906 12:132512435-132512457 GCTGAGCTCCAGGCTGGACCTGG + Intronic
1111611804 13:90615504-90615526 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
1113666427 13:112144697-112144719 CTTGACCCCCTGCCTGGATCTGG + Intergenic
1114481133 14:23035278-23035300 CTTGGACACCAGGCTGGAGTGGG - Intergenic
1114534163 14:23412515-23412537 CTTTAAATCCTGGCTGGACCAGG + Intergenic
1118736525 14:68705164-68705186 CAGGAGCCCCAGGCTGGATCAGG + Intronic
1120177817 14:81313926-81313948 CTTGAACCTCAGGCTAGATCAGG - Intronic
1121682482 14:95805225-95805247 CTTGAATCCCTGGCTAGATCAGG - Intergenic
1122921067 14:104880382-104880404 CTCGAACCCCAGGCCGGAGAAGG + Exonic
1122923956 14:104891390-104891412 CTTGAAGCCCATGAGGGACCTGG + Intronic
1124621698 15:31277643-31277665 CTGCAGGCCCAGGCTGGACCAGG - Intergenic
1125884030 15:43215061-43215083 CATGCAGCCCAGGCTGGCCCAGG + Intronic
1126108622 15:45162883-45162905 CTTTCACACCAGCCTGGACCTGG + Intronic
1127461166 15:59200496-59200518 CTGAAAGCCCAGGCTGGACTCGG + Intronic
1127489633 15:59450145-59450167 CTTGAACCCAGGACTGGGCCTGG - Intronic
1127692127 15:61407386-61407408 CTTGAAGCCCAGGCTGGTGTAGG - Intergenic
1128995129 15:72289744-72289766 CTTGACCACGAGGCTGGACGAGG + Exonic
1132214908 15:100055346-100055368 CATCAGCCCCAGGCTGGAGCAGG + Intronic
1133245094 16:4443308-4443330 CTGGAGCCCCAGGCTGGAGGAGG + Intronic
1133724613 16:8525915-8525937 CATGAGCACCTGGCTGGACCTGG + Intergenic
1134552739 16:15145550-15145572 CAGGAACGCCAGGCTGGGCCAGG + Intergenic
1135417674 16:22280974-22280996 CTTGTAGCCCAGGCTGGAGTGGG + Intronic
1135594035 16:23727807-23727829 CTTAAACCCCAGTGTGGGCCGGG - Intergenic
1136069997 16:27782029-27782051 CTTGAACCCCAGGCTGGAGGTGG - Intergenic
1136776318 16:32873715-32873737 CTTGCTCCCCGGGCTGGGCCAGG + Intergenic
1136894297 16:33987797-33987819 CTTGCTCCCCGGGCTGGGCCAGG - Intergenic
1138681108 16:58684324-58684346 CTCCAACCCCAGGCTGGACTGGG - Exonic
1138902911 16:61296368-61296390 CTTGACTCCCAGGCAGGAACTGG + Intergenic
1139311661 16:66032915-66032937 CTGGAACCTCAGACAGGACCTGG + Intergenic
1139582139 16:67880081-67880103 CTTGAGCCCCAAGCTGCAGCTGG + Exonic
1139614827 16:68082651-68082673 GTGGAACCCCAGGGTGGACAAGG - Intergenic
1140019574 16:71225255-71225277 CTTGAACCCAAACCTGGGCCTGG + Intronic
1141170238 16:81686375-81686397 TGAGAACCCCAGGCTGCACCTGG + Intronic
1142009511 16:87706703-87706725 CCTGAACACCCGGCTGCACCAGG + Intronic
1142115241 16:88352944-88352966 CTCCCACCCCAGGCTGGGCCTGG - Intergenic
1203078733 16_KI270728v1_random:1135824-1135846 CTTGCTCCCCGGGCTGGGCCAGG + Intergenic
1143012929 17:3876187-3876209 CTTGAACCCCAGCCTGGCCCAGG + Intronic
1146255751 17:31390991-31391013 ACTGAACCCCAGCCTGGACCCGG - Intergenic
1147862876 17:43533837-43533859 GGTGAGCCCCAGCCTGGACCTGG - Exonic
1148923932 17:51065321-51065343 ATTGAAATCCAGGCTGGGCCTGG - Intronic
1149638947 17:58190997-58191019 CATGTACCCCAGGTTGGAGCTGG - Intergenic
1150431764 17:65123838-65123860 TTTGAACCCCAGGCTGGAACTGG + Intergenic
1152091586 17:78250523-78250545 ACTGAACCCCAGGATGGGCCAGG + Intergenic
1153652337 18:7252242-7252264 CTTGAAACCCAGGTTGGAGTGGG + Intergenic
1153903509 18:9639806-9639828 CTTGTCCCCCAGGCTGGAGTGGG + Intergenic
1155053004 18:22164782-22164804 TTTGAACCCCAGGCTGAAGGTGG - Intergenic
1156452422 18:37274428-37274450 CTTGACCACCAGACTGGACGAGG + Exonic
1158303938 18:56083832-56083854 CTTGACCCCCAGGCTGTCCTGGG + Intergenic
1161226360 19:3148376-3148398 CATGAACCTCAGGCTGGGCACGG - Intronic
1161251194 19:3281203-3281225 CTTGACCACCAGGCTGGAGGAGG - Exonic
1162193649 19:8966855-8966877 CTGGAACTCCAGGAGGGACCAGG - Exonic
1162958755 19:14114006-14114028 TGTGAACCCCTGGCTGGCCCTGG - Intronic
1163531040 19:17849058-17849080 CTTGGACCCGAGGCAGGACAGGG + Intergenic
1163747588 19:19057466-19057488 CTCGAAGCCCATCCTGGACCTGG + Exonic
1164210457 19:23093564-23093586 CTTGATCCCCGGGCTGGGACAGG + Intronic
1166007538 19:39917688-39917710 CCTGCTCCCCAGGCTGGGCCAGG + Intronic
1166715052 19:44961610-44961632 CCCGAACCCTAGACTGGACCAGG + Intronic
1166742582 19:45123252-45123274 AGTGCACCCCAGGCTGGACCAGG + Intronic
1166748685 19:45154274-45154296 CCTGATCCCCAGGCTGGGTCGGG + Intronic
1167611154 19:50508259-50508281 CCTGACCTCCAGGCTGGATCGGG + Intronic
1167756207 19:51415262-51415284 CTTGAACCCGAGGCAGCTCCAGG + Exonic
925578052 2:5380975-5380997 CTTGTTGCCCAGGCTGGACACGG - Intergenic
926116573 2:10217453-10217475 GCTGAACCCCAGCCTGGAACTGG - Intergenic
926678231 2:15644599-15644621 CTGAACCCCCAGGCTGGGCCAGG - Intergenic
926838658 2:17053013-17053035 ATTGGACCACAGGCTGCACCTGG + Intergenic
927297987 2:21477093-21477115 CTTGAACCCAAGCCAGGGCCTGG - Intergenic
928435770 2:31253653-31253675 CTCGGGCCCCAGGCTGGACTAGG + Intronic
930416771 2:51098885-51098907 CTTGGACCCAAGTCTGGGCCTGG + Intergenic
931422738 2:62143223-62143245 CTGGAGCCCCAGGCTGACCCTGG + Intronic
931623003 2:64229903-64229925 TTGGAACCTCAGGCTGGTCCTGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933090055 2:78107810-78107832 CTGGAGTTCCAGGCTGGACCGGG - Intergenic
934142457 2:89060826-89060848 CTTGAACCCCAGAGTTGATCTGG - Intergenic
934226782 2:90139728-90139750 CTTGAACCCCAGAGTTGATCTGG + Intergenic
934989650 2:98912408-98912430 CTCGATCCCCAGGCATGACCTGG + Intronic
937976179 2:127583353-127583375 CCTGCACCCCCGGCTGGCCCTGG - Intronic
937992368 2:127671777-127671799 CCTGAGCCCCAGACTGGGCCAGG - Intronic
939886757 2:147689573-147689595 TCTGAACCCCAGGATGGTCCTGG + Intergenic
939932883 2:148255722-148255744 CTGGAGTTCCAGGCTGGACCTGG - Intronic
940615863 2:156047897-156047919 CTTGAGCCCCTGGCTGGAGTTGG - Intergenic
943153695 2:184146803-184146825 TTAGAACTCCAGGCTGGGCCTGG - Intergenic
948073306 2:235144913-235144935 CATCACTCCCAGGCTGGACCAGG - Intergenic
948289358 2:236813829-236813851 CTTGAACCCCACCCAGCACCTGG + Intergenic
1169274213 20:4222012-4222034 CTTGAACTCGCGGCTGGAACAGG + Exonic
1169278038 20:4246642-4246664 CTGGGACCACAGGCTGGAACTGG - Intronic
1170573718 20:17647395-17647417 CTTGCACCCGAGGTTGGACTAGG + Intronic
1171210114 20:23310402-23310424 CTTGCAACCCAGGCTGGTGCAGG - Intergenic
1172211920 20:33205853-33205875 CTTTAACCACATGCTGGTCCAGG - Intergenic
1172527193 20:35607045-35607067 CCTGAACCCCAGGTTGGACTTGG + Intergenic
1172776316 20:37409270-37409292 CTTGAGGCTGAGGCTGGACCAGG - Intergenic
1173660226 20:44728023-44728045 CTTGTTGCCCAGGCTGGAGCTGG + Intronic
1175448818 20:59045171-59045193 ATTGCACTCCAGGCTGGGCCTGG - Intergenic
1176035900 20:63036319-63036341 CTTGGACCCCAGGCTGGAGGGGG - Intergenic
1178138213 21:29652253-29652275 CTTGCACCCCAGGCTGTTCCAGG + Intronic
1179902142 21:44399836-44399858 CTGGAACCCCCGGCAGGGCCTGG + Intronic
1181408443 22:22701647-22701669 GCTGTACCCCAGGCTGGAGCTGG - Intergenic
1182083881 22:27548247-27548269 CATGAACCCCAGAAAGGACCAGG + Intergenic
1182473982 22:30565882-30565904 CTAGAACCCCATCATGGACCAGG + Intronic
1183086281 22:35489275-35489297 CTGGAACCCCTGGCAGTACCTGG + Intergenic
1183778790 22:39985301-39985323 CTTGAACCCCAAGCTGGGGGTGG - Intergenic
1184661283 22:45966734-45966756 CTCCATCCCCAGGCTGGAGCAGG - Intronic
1184813845 22:46855557-46855579 CTTGACTCCCAGGCTGCACAAGG - Intronic
1184960340 22:47923894-47923916 CTAGATTCCCAGGCTGGGCCAGG + Intergenic
950185890 3:10945332-10945354 CTTGTAGCCCAGGCTGAGCCAGG + Intergenic
950499363 3:13354068-13354090 CCGCAACCCCCGGCTGGACCTGG - Exonic
950864516 3:16178574-16178596 CTTGAACCGCAGACTGGAGAGGG - Intronic
952807999 3:37375374-37375396 CTTTAAGCCAAGGCTGGAGCTGG + Intergenic
954640053 3:52092451-52092473 CTGGACCCCGAGGCTGGTCCAGG + Intronic
954654563 3:52186121-52186143 CCCCAACCCCAGGCTGGATCTGG + Intergenic
955678397 3:61473814-61473836 CTTGTTCCCCAGGCTGCACCAGG + Intergenic
958951724 3:100424258-100424280 CGTGAACCTCAGGTTGGTCCTGG - Intronic
961516342 3:127439806-127439828 TGAGAACCCCAGGCTGGTCCAGG + Intergenic
962260219 3:133897340-133897362 CTTCAACCCCAAGCTGGATATGG - Intergenic
966885956 3:184378273-184378295 CTGGAGCCCCTGCCTGGACCAGG + Intronic
967501202 3:190200163-190200185 CTTGTTGCCCAGGCTGGAGCTGG - Intergenic
968474080 4:794979-795001 CTTGAGCCCTGGGCTGGTCCAGG + Intronic
969283757 4:6189748-6189770 CTCCATCCCCAGGCTGGGCCAGG - Intronic
969297284 4:6277585-6277607 CCCGGACCCCAGGCTGGCCCTGG + Exonic
970232907 4:13929003-13929025 CTGTAACCCCAGACTGGGCCAGG - Intergenic
970349329 4:15185546-15185568 GATGAACCCCAGGGTGAACCTGG + Intergenic
971673344 4:29593163-29593185 CTTGAACTCAACTCTGGACCAGG - Intergenic
971695917 4:29902685-29902707 GTTAGACCCCAGGCTGGGCCTGG + Intergenic
972852723 4:43070820-43070842 CCTGAACCCCAGGCTCCACAAGG + Intergenic
973131558 4:46654145-46654167 CTTTAAGCCAAGGCTGGAGCTGG + Intergenic
975182354 4:71361324-71361346 CTTGAACCCCAAGCCATACCAGG - Intronic
977575220 4:98666985-98667007 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
977975920 4:103267125-103267147 ATAGGACCCCAGGCTGGGCCTGG + Intergenic
978343197 4:107739001-107739023 CTTGATCTCCAGACTGGAACGGG - Intergenic
983988040 4:174083900-174083922 CTTGAAGCCAAGGCAGGTCCAGG + Intergenic
986300910 5:6477485-6477507 CCAAAACCCAAGGCTGGACCTGG + Intronic
989256178 5:39367674-39367696 CTTGTCCCCCAGGCTGGAGTGGG - Intronic
989384468 5:40841081-40841103 CTTGAACTTCAGGTTGGACTAGG - Intergenic
991000438 5:61777483-61777505 CTAGCACCCCCGGCAGGACCTGG - Intergenic
992329670 5:75703078-75703100 GTTTCACCTCAGGCTGGACCTGG - Intronic
995790829 5:115884481-115884503 CTTGAACCCCAGGCGGGGAGGGG + Intronic
995994756 5:118284280-118284302 CTTGCACACCAGACTGGAGCTGG + Intergenic
998332864 5:141344988-141345010 ATTGAAGCACAGGATGGACCAGG + Exonic
1001149835 5:169217556-169217578 CAGGAACCCCAGGCTGGATCAGG - Intronic
1001950680 5:175814531-175814553 CTTGAACACCAGGCTGACACGGG - Intronic
1001982058 5:176044489-176044511 CTTGAACCCCAGGCTCCAAGTGG - Intergenic
1002235404 5:177799568-177799590 CTTGAACCCCAGGCTCCAAGTGG + Intergenic
1002424124 5:179165790-179165812 CTGGGGCCCTAGGCTGGACCTGG - Intronic
1002465739 5:179407582-179407604 CTGGACCCCCAGGCTCGCCCAGG + Intergenic
1002955546 6:1859659-1859681 CTGGAAGCACAGCCTGGACCAGG + Intronic
1003109107 6:3238698-3238720 CTTGTTGCCCAGGCTGGAGCGGG + Intronic
1003315079 6:5004333-5004355 CTTGGACCCCAGCCTGGCGCCGG + Intergenic
1005826034 6:29632485-29632507 CTTGGTCCCCAGGCTGAGCCCGG - Intronic
1007096737 6:39217874-39217896 GTTGAACCCCAGGCTGGGAAAGG - Intronic
1007587818 6:43002645-43002667 CGGGACCCACAGGCTGGACCCGG + Intronic
1009635704 6:66262113-66262135 CGTGAACCTCAGGCTGGTGCTGG - Intergenic
1010723541 6:79309652-79309674 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
1014755212 6:125295399-125295421 TTTGAAACCCAGTCTGGATCTGG - Intronic
1015429156 6:133110105-133110127 CTTGAAGCCCAGACAGGACAGGG + Intergenic
1018682008 6:166272118-166272140 CTTGGAGCGCAGGCTGTACCAGG - Intergenic
1019472731 7:1229908-1229930 CCTGGACCGCGGGCTGGACCGGG + Intergenic
1019526660 7:1483468-1483490 CTCTGACCCCAGGCTGTACCAGG + Intronic
1020012758 7:4815616-4815638 CTTGAACCCCTCTCTGGAGCGGG + Intronic
1021180231 7:17497461-17497483 CCTGATGCCCAGGCTGAACCTGG - Intergenic
1024290950 7:47803586-47803608 TTTGAACACCAGGATGGAGCAGG + Intronic
1025728263 7:64087709-64087731 TTTGAAGCACAGGCTGTACCTGG + Intronic
1025757376 7:64357559-64357581 TTTGAAGCACAGGCTGTACCTGG + Intergenic
1027684682 7:81266188-81266210 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
1034675875 7:152892225-152892247 CTTTCCCCCCTGGCTGGACCAGG + Intergenic
1035444864 7:158933400-158933422 CTTGAGCCCCATGCAGAACCAGG + Intronic
1039680527 8:39730495-39730517 CTTGAACCTCAGGCCGGGCTGGG + Intergenic
1044047476 8:87454662-87454684 CATGAACCCCAAGCTGGAGAGGG - Intronic
1047076786 8:121413037-121413059 CTTGTACCTTAGGCTGGTCCAGG + Intergenic
1049207558 8:141370550-141370572 CTTGAACCCAGGGCTGCACAAGG - Intergenic
1049245900 8:141562379-141562401 CTCCAAGCCCAGGCTGGAGCAGG + Intergenic
1049374791 8:142284281-142284303 CCTGGACCCCAGCCTGGGCCTGG + Intronic
1049617818 8:143583551-143583573 CTTGCACCCCTGGCTTGCCCAGG - Intronic
1049658233 8:143808302-143808324 CTTGGACCCCAGGCCTGCCCTGG - Intronic
1049658244 8:143808343-143808365 CTTGGACCCCAGGCCTGCCCTGG - Intronic
1051522318 9:18003032-18003054 TTTGAACTCCAGGATGGGCCTGG - Intergenic
1053364209 9:37511393-37511415 CCCCAACCCCAGGCTGGATCTGG + Exonic
1053445062 9:38146330-38146352 CCTGGACCCCAGGCTGTCCCTGG - Intergenic
1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG + Intronic
1060407730 9:123381224-123381246 GTTGATTCCCAGGCTGGAACTGG + Exonic
1060896136 9:127218804-127218826 CTGGGAACCCAGGCTGGGCCTGG + Exonic
1061037151 9:128120259-128120281 CTTCAGCTCCAGGCTGGGCCAGG - Intergenic
1061060519 9:128247984-128248006 CTTGAAAACCTGGCTGGAGCTGG - Intronic
1061741086 9:132706818-132706840 CTTGCATCCCAGCCTGGACCTGG - Intergenic
1061781865 9:133000845-133000867 CTTGCACCCCAGGCTGGCAGAGG - Intergenic
1062015058 9:134287222-134287244 CCTGAACCACAGCCTGGTCCTGG - Intergenic
1062026050 9:134341329-134341351 CCAGAACCCCAGGCTGGAAGTGG - Intronic
1062320105 9:135986577-135986599 CGTGCCCCCCAGGCTGGCCCTGG - Intergenic
1062454444 9:136629079-136629101 CTTGACCCCCAGCCTGGGCATGG + Intergenic
1189212728 X:39298410-39298432 CTTCAACCAAAGGCTGGACAAGG - Intergenic
1192231344 X:69267309-69267331 CTTGCACCCCTGGGTGGAACAGG + Intergenic
1193573693 X:83175122-83175144 CTTGCACAGCAGCCTGGACCTGG + Intergenic
1200053873 X:153448684-153448706 CTTGAGCCCCAGGCACCACCAGG + Intronic
1202249305 Y:22853381-22853403 TTTGAACCACAAGCTGTACCTGG - Intergenic
1202402291 Y:24487129-24487151 TTTGAACCACAAGCTGTACCTGG - Intergenic
1202468489 Y:25182955-25182977 TTTGAACCACAAGCTGTACCTGG + Intergenic