ID: 1059447347

View in Genome Browser
Species Human (GRCh38)
Location 9:114346710-114346732
Sequence CTGGCTCGCTGCCTTCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059447341_1059447347 0 Left 1059447341 9:114346687-114346709 CCTCCCGAGGCACTGAGGAAGAC 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 298
1059447342_1059447347 -3 Left 1059447342 9:114346690-114346712 CCCGAGGCACTGAGGAAGACCTG 0: 1
1: 0
2: 0
3: 21
4: 330
Right 1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 298
1059447343_1059447347 -4 Left 1059447343 9:114346691-114346713 CCGAGGCACTGAGGAAGACCTGG 0: 1
1: 0
2: 2
3: 35
4: 317
Right 1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059447347 Original CRISPR CTGGCTCGCTGCCTTCCTGG AGG Exonic