ID: 1059447347

View in Genome Browser
Species Human (GRCh38)
Location 9:114346710-114346732
Sequence CTGGCTCGCTGCCTTCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059447341_1059447347 0 Left 1059447341 9:114346687-114346709 CCTCCCGAGGCACTGAGGAAGAC 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 298
1059447343_1059447347 -4 Left 1059447343 9:114346691-114346713 CCGAGGCACTGAGGAAGACCTGG 0: 1
1: 0
2: 2
3: 35
4: 317
Right 1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 298
1059447342_1059447347 -3 Left 1059447342 9:114346690-114346712 CCCGAGGCACTGAGGAAGACCTG 0: 1
1: 0
2: 0
3: 21
4: 330
Right 1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059447347 Original CRISPR CTGGCTCGCTGCCTTCCTGG AGG Exonic
900409109 1:2504874-2504896 CTGGCTCACTGTCTTCCAGCAGG + Exonic
900432452 1:2609305-2609327 CTGCCTCGGCCCCTTCCTGGCGG + Intronic
900476668 1:2879385-2879407 CTGGGTCCCTGAGTTCCTGGTGG + Intergenic
900677525 1:3897567-3897589 CTTTCTCTCTGCATTCCTGGTGG - Intronic
901190631 1:7407842-7407864 CTGGCTCCCTCCCTTCCTGGGGG - Intronic
901237650 1:7676118-7676140 CTGGCCACCTGCCTTCCTGTTGG + Intronic
901867306 1:12115490-12115512 CTGCTTCTCTGTCTTCCTGGGGG + Intronic
902224252 1:14986774-14986796 CTGACTGGCTGCCTTCCCTGAGG + Intronic
903332337 1:22602508-22602530 CCGGCTGGCCGCCTTCATGGAGG + Exonic
904042658 1:27593414-27593436 CTGGGTCCCAGCCTGCCTGGGGG - Intronic
904086665 1:27914277-27914299 CTTCCTCGCCGCCTTCCTGCGGG + Intronic
904508726 1:30983076-30983098 TTGACTGGCTCCCTTCCTGGAGG - Intronic
905364044 1:37439168-37439190 CTGCCTCTCAGCCTTGCTGGTGG - Intergenic
906214681 1:44031726-44031748 CTGCCTCGCTGCCCTCCAGCTGG + Intergenic
908842665 1:68294963-68294985 CTGCCTCTATGCCTCCCTGGAGG - Intergenic
909445585 1:75744713-75744735 CTCGCTCTCTGCCTTCCAGAAGG - Intronic
910807663 1:91204765-91204787 ATGGCTTGGTGCCCTCCTGGTGG - Intergenic
911053652 1:93693177-93693199 CTGGCTTGCTCCCTTGCAGGAGG - Intronic
911077461 1:93891385-93891407 ATGGCTCACTCCCTTCCTGCAGG + Intronic
911822114 1:102435844-102435866 CTGGCTCTCAGCCTCCCTGTAGG + Intergenic
913611150 1:120510980-120511002 CTGGCTGGCTGCCTTCAGTGTGG - Intergenic
914000666 1:143691848-143691870 CTGGGTCGCTGGGTCCCTGGCGG - Intergenic
914197985 1:145460043-145460065 CTGGGTCGCTGGGTCCCTGGCGG - Intergenic
914245333 1:145881574-145881596 CTAGCTCTCTGCTTTCCTGGGGG - Intronic
914477087 1:148033175-148033197 CTGGGTCGCTGGGTCCCTGGCGG - Intergenic
914503094 1:148264786-148264808 CTGGGTCGCTGGGTCCCTGGCGG + Intergenic
914510632 1:148329200-148329222 CTGGGTCGCTGGGTCCCTGGCGG - Intergenic
914580040 1:149011259-149011281 CTGGCTGGCTGCCTTCAGTGTGG + Intronic
919745772 1:201008387-201008409 CTGGCTCTCTCCCTTCCTTCTGG - Intronic
919854708 1:201697310-201697332 CTGCCTGGCTGCCTCCCTGGAGG - Intronic
920066325 1:203272515-203272537 CAGGATCACTGCCTTCTTGGTGG - Intronic
920111238 1:203588774-203588796 CTGGCCCATTGCCTTCCTGGTGG - Intergenic
920533862 1:206724427-206724449 CAGGCTGGCTGACGTCCTGGGGG - Intronic
923000521 1:230003077-230003099 CTGCCTGGCTGCTTTCCTGGAGG - Intergenic
923368447 1:233286427-233286449 CTGGCTAGCTGCTTTGATGGAGG + Intronic
923877756 1:238068198-238068220 CTGTCTCCCTGACTCCCTGGTGG - Intergenic
924094707 1:240539263-240539285 CTGGCTTGTGGTCTTCCTGGTGG + Intronic
1063167692 10:3478905-3478927 CTGGCTGGCTGCCTTCCTGTGGG + Intergenic
1065045460 10:21744413-21744435 GTAGCTCTCTGGCTTCCTGGAGG + Intergenic
1066135978 10:32446486-32446508 CTGCCTGGCTGCCTCCGTGGCGG + Exonic
1067151230 10:43736572-43736594 TAAGCTGGCTGCCTTCCTGGTGG + Intergenic
1068831118 10:61495981-61496003 ATGGCTCTCTTCCTTTCTGGAGG - Intergenic
1069549527 10:69353204-69353226 CAGGCTCTCTCCCTCCCTGGAGG - Intronic
1069801397 10:71084149-71084171 CTGGCTCTCTGCCTTCTCCGAGG - Intergenic
1070144619 10:73764768-73764790 CTGGCTCGCTCTCTTCATGCTGG - Intronic
1070284872 10:75075613-75075635 CTGGCTCGCTCCCATCTTGATGG - Intergenic
1070681736 10:78453618-78453640 CTGGCAGGCTGCCCTGCTGGGGG - Intergenic
1071326476 10:84523688-84523710 CTGGCTCTCTGCCAGGCTGGAGG + Intergenic
1076121517 10:127940396-127940418 CAGGCTCACAGCCTTCCTGATGG + Intronic
1077300904 11:1846495-1846517 CTGGGTCCCTGCCTACCTGGTGG - Intergenic
1078405690 11:11068160-11068182 CTGGCAGGCTGTCTTTCTGGGGG + Intergenic
1078813329 11:14794222-14794244 CTTGCTCGCTTGCTTGCTGGTGG - Intronic
1083326727 11:61876739-61876761 CTGCCTCCCTGGCTTGCTGGTGG - Intronic
1084148436 11:67277149-67277171 CGGGCTGGCCTCCTTCCTGGAGG + Intronic
1084502192 11:69541354-69541376 CTGGTCCCATGCCTTCCTGGGGG - Intergenic
1084528497 11:69712576-69712598 CTGGCTCTCCGCCTTGCTGCAGG - Intergenic
1084741254 11:71140849-71140871 CCTGCTGGCTGCCTTCCTGCCGG + Intronic
1084764939 11:71302094-71302116 CTGGCTGGCTGGCTAGCTGGGGG + Intergenic
1085189173 11:74602917-74602939 CTGGCTCCCTCCCTCCCTGCAGG + Intronic
1085742315 11:79087929-79087951 CTGCCTCTCTACCTTCCAGGAGG + Intronic
1087439407 11:98163584-98163606 CTGCCTCACTGCCTTCCAAGGGG + Intergenic
1091288308 11:134421573-134421595 CTGGCTCCCTTCCGCCCTGGAGG + Intergenic
1091557375 12:1584473-1584495 GAGGCCAGCTGCCTTCCTGGGGG + Intronic
1091968011 12:4761903-4761925 CTGACTCCCTGTCTTTCTGGGGG - Intronic
1095640406 12:44479886-44479908 CCAGCTCTCTGCCTTCCTGTAGG + Intergenic
1101473407 12:105020736-105020758 CTGGCTGGCTCACTTCCTGCAGG - Exonic
1102030701 12:109738539-109738561 GGGCCTCGCAGCCTTCCTGGGGG - Intronic
1102399692 12:112617658-112617680 CTGCCTCGGAGACTTCCTGGAGG + Intronic
1102603060 12:114047482-114047504 CTAGCATGCTCCCTTCCTGGGGG - Intergenic
1103415279 12:120738870-120738892 CTGGCGCGCTGCCATGCTGAAGG + Exonic
1103432980 12:120903985-120904007 CTGGCTCGCTGGCTGCACGGCGG + Exonic
1103605323 12:122081727-122081749 CTGTCTGGCTTCCATCCTGGTGG + Intronic
1104126905 12:125856280-125856302 CTGGCTGGCAGCCATGCTGGAGG + Intergenic
1104810593 12:131617914-131617936 CTGGCTCCCTGCGTGCCTGGAGG - Intergenic
1111864073 13:93745858-93745880 CTGGCTTGCTGCTTTCATGCTGG - Intronic
1112180029 13:97069360-97069382 GTGGCTCTCTGCCCTCCTGATGG + Intergenic
1112494335 13:99893667-99893689 CTGGCTGGCTGGCTGCCTGTGGG - Exonic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113884953 13:113653648-113653670 CTGGCTGGCTGCCATGGTGGGGG + Intronic
1117942735 14:60985975-60985997 ATGGCTTGGTGCCTTCCTTGGGG - Intronic
1119893077 14:78197615-78197637 CTCCCTTGCTTCCTTCCTGGTGG + Intergenic
1120041506 14:79758485-79758507 ATGGCTTGGTGCCTTCCTCGAGG - Intronic
1121733998 14:96205438-96205460 CCAGCTCGCTGGCTCCCTGGGGG + Intronic
1122854742 14:104554684-104554706 CAGCCTCGCTGCCCTCCTGCAGG + Intronic
1123758167 15:23413114-23413136 GTGGCCCCCAGCCTTCCTGGTGG + Intergenic
1124218082 15:27825823-27825845 CTGGCCGGCTGCCTTCCATGGGG - Intronic
1126412971 15:48390944-48390966 CGTGTTCTCTGCCTTCCTGGAGG + Intergenic
1128108001 15:65058563-65058585 CTGGGCCCATGCCTTCCTGGTGG - Exonic
1129334756 15:74845260-74845282 CTGGATGGCTGGCTTCCTGGTGG - Intronic
1130551928 15:84894938-84894960 AGGGCTCTCTGCCTTCCTGCTGG + Exonic
1132621415 16:869879-869901 GTGGTTCGCGGCCTTCCAGGTGG - Exonic
1132798878 16:1741702-1741724 GTGGCTGGCTGCCTTCACGGTGG + Intronic
1133322899 16:4925219-4925241 CTGGCGTCCTGCCTGCCTGGAGG + Intronic
1136011120 16:27363898-27363920 CAGCCTGGCTGCCTTCCAGGAGG - Exonic
1136171341 16:28491654-28491676 CTGGCTCGCAGCCCACCTGAGGG - Intronic
1137456219 16:48619930-48619952 CTGTCCCGCTTCCTTCCTGAGGG - Intronic
1137456307 16:48620677-48620699 CTGGCTCAGTCCCTTCCTAGTGG - Intergenic
1137567417 16:49542223-49542245 CTGGGTCTCTGCCTTCATGGGGG + Intronic
1138029436 16:53548282-53548304 CTTGCTTCCTGCTTTCCTGGAGG + Intergenic
1138249031 16:55488462-55488484 CTGGCTGGCTGCCCACCTGCCGG - Intronic
1139909833 16:70390965-70390987 CTGGCTCCCTGTGTTCCTAGTGG - Intronic
1141103725 16:81216185-81216207 CTGTCTCCCTGCCTGCCTGCAGG - Intergenic
1141999100 16:87653916-87653938 GCAGCTGGCTGCCTTCCTGGAGG - Intronic
1142169953 16:88616521-88616543 CAGGCCCGCTACCTGCCTGGAGG + Intronic
1142305546 16:89282575-89282597 GGGGCTGACTGCCTTCCTGGAGG - Exonic
1142612198 17:1115215-1115237 CTGGCTTGGTGGCTTCCTGCTGG - Intronic
1142694143 17:1623992-1624014 CTGGCGCCCTGCTTTCTTGGGGG + Intronic
1144214003 17:13038708-13038730 ATGGCTTGGTGCCATCCTGGTGG + Intergenic
1144298025 17:13897821-13897843 CGTGCTCCCTGCCTGCCTGGAGG + Intergenic
1144707614 17:17380003-17380025 TTGGCTCCATTCCTTCCTGGGGG + Intergenic
1148002128 17:44395444-44395466 CTGCCTCTTTGCCTTCCTAGGGG - Intronic
1148857854 17:50588737-50588759 CTGGCTGTCTGCCTGCCTGCTGG + Intronic
1149623650 17:58064548-58064570 CTGCCTCCCTCCCTCCCTGGTGG + Intergenic
1150421134 17:65036936-65036958 CTGTCTGGCTGCCTTAATGGGGG - Intronic
1152830777 17:82495935-82495957 CTTGCCCTCTGCCTTCCAGGCGG + Intergenic
1153635134 18:7106932-7106954 CTGGCTGGCTGCTTTATTGGAGG - Intronic
1154335968 18:13464994-13465016 TTGGCTCGCTCCCTTCCTCCCGG - Intronic
1155117412 18:22783557-22783579 CTGGGTCCCTCCCTACCTGGAGG + Intergenic
1155343450 18:24835957-24835979 CTGGCTTCCTGCCTTCAGGGAGG + Intergenic
1157157316 18:45280641-45280663 CTGACTCTCAGCCCTCCTGGAGG + Intronic
1158655502 18:59327366-59327388 CTGGCTCTCTCACTTACTGGAGG - Intergenic
1161098088 19:2405377-2405399 GTGGCTTGCAGCCTGCCTGGAGG + Exonic
1161495293 19:4583188-4583210 CTGGCTCCGTGCCATCCAGGGGG + Intergenic
1161797200 19:6393869-6393891 GCGGCTGGCTGGCTTCCTGGGGG + Intronic
1161995143 19:7707290-7707312 CTGGCTCTCTGCCTGAGTGGGGG - Intergenic
1162478543 19:10915139-10915161 CTGGCTGGCTGTGCTCCTGGAGG + Intronic
1162799713 19:13103771-13103793 CTGGGTGCCTGCCTGCCTGGGGG - Intergenic
1163186780 19:15644428-15644450 CAGGCTGGAAGCCTTCCTGGAGG + Intronic
1163304738 19:16471174-16471196 CAAGGTCGCTGCTTTCCTGGAGG - Intronic
1163627097 19:18396501-18396523 CAACCTCTCTGCCTTCCTGGAGG - Exonic
1165283299 19:34816088-34816110 CTGGCCAGCTGCATTCCAGGTGG - Intergenic
1165787318 19:38469399-38469421 ATGGCTCGAAGCCTTCCTGGAGG - Exonic
1166948910 19:46413486-46413508 CTGGGTGGCGGCCTGCCTGGGGG - Exonic
1167118199 19:47500449-47500471 CTGGCTCTCTTCCTTCCAGTTGG - Intronic
925159658 2:1675171-1675193 CTGGCTCGCCGTGTTTCTGGTGG - Intronic
925263753 2:2549961-2549983 CTGGCTGGCTGGCTGGCTGGAGG + Intergenic
926142233 2:10374603-10374625 CTGTCTCCCTGCATTTCTGGAGG - Intronic
926908707 2:17829656-17829678 CTACCTCGCAGCCTTGCTGGAGG - Intergenic
927055394 2:19361595-19361617 CTCGCTCACTGCCTTCGGGGCGG + Intergenic
931172171 2:59814918-59814940 CTGGCTCGCTGAGGTCCTGGAGG - Intergenic
931567276 2:63627876-63627898 CTGACCCTCTGCCCTCCTGGTGG + Intronic
934265041 2:91505403-91505425 CTGGCTGGCTGGCTGGCTGGCGG + Intergenic
934265329 2:91506680-91506702 CTGGCTGGCTGGCTGGCTGGCGG + Intergenic
934265424 2:91507108-91507130 CTGGCTGGCTGGCTGACTGGCGG + Intergenic
934265567 2:91507732-91507754 CTGGCTGGCTGGCTGGCTGGCGG + Intergenic
934266752 2:91513046-91513068 CTGGCTGGCTGGCTGGCTGGCGG + Intergenic
934266847 2:91513474-91513496 CTGGCTGGCTGGCTGACTGGCGG + Intergenic
934266990 2:91514097-91514119 CTGGCTGGCTGGCTGGCTGGCGG + Intergenic
934268528 2:91520952-91520974 CTGGCTGGCTGGCTGGCTGGCGG + Intergenic
934268724 2:91521843-91521865 CTGGCTGGCTGGCTGGCTGGCGG + Intergenic
934269470 2:91525160-91525182 CTGGCTGGCTGGCTGGCTGGCGG + Intergenic
934557816 2:95296734-95296756 GTGGCTCCCTGCTGTCCTGGGGG + Intergenic
934751203 2:96795282-96795304 CTGGCCCGCTGCCGCCCTGCTGG + Intronic
935849358 2:107201535-107201557 TTGTTTCCCTGCCTTCCTGGCGG - Intergenic
936093573 2:109515867-109515889 ATGGCTTGGTGCGTTCCTGGCGG - Intergenic
936146223 2:109982045-109982067 CTGGCTCCCTCCATACCTGGTGG + Intergenic
936198468 2:110389434-110389456 CTGGCTCCCTCCATACCTGGTGG - Intergenic
938137982 2:128774875-128774897 CTGGGCCTCTGCCTTCCTGCTGG + Intergenic
938904966 2:135828539-135828561 CTGGAGAGCTGCCTTCCTGTGGG - Intronic
938937425 2:136139279-136139301 CTGGCTTGCTGCCTTCATGCTGG + Intergenic
940037749 2:149329212-149329234 CTGCCGCGCTGTCTTCCTGCAGG - Intergenic
942657199 2:178226246-178226268 CTTGCTCGCTGGCTTCCAGAGGG - Intronic
942890339 2:180980540-180980562 CGTGCTCGCTGCTTGCCTGGCGG - Intronic
943477657 2:188378731-188378753 ATGGCTTGGTGCCATCCTGGTGG - Intronic
944097331 2:195983550-195983572 ATGGCTTGGTGCCTTCCTGATGG - Intronic
944133555 2:196373176-196373198 CTAGCCAGCTGCCTTCCTGGTGG - Intronic
944167508 2:196738715-196738737 TTGGCTCTCTGCCTGCCTGTTGG + Intronic
945188721 2:207165653-207165675 CTGGATGTCTGCCTTCTTGGGGG - Exonic
946907283 2:224429355-224429377 CTGGCTCCCTCCCTCCCTGCAGG + Intergenic
947971587 2:234329310-234329332 CTGTCTCCCTGCCTTCCTCCTGG - Intergenic
948730844 2:239962902-239962924 ATGGCTTGGTGCCCTCCTGGAGG - Intronic
948807077 2:240457663-240457685 CTGGCTCGAGGCTGTCCTGGGGG - Intronic
948867159 2:240782037-240782059 CTGGCTCACTCCGTTCCTGCCGG + Intronic
1169519632 20:6356867-6356889 CTGGCTGGCTGGATTCCTGATGG + Intergenic
1170593169 20:17786633-17786655 CTGGGTCTCTGCCTTTCTGTTGG - Intergenic
1171248464 20:23632018-23632040 CTGGCTCACTGGCCTCATGGGGG + Intronic
1171456334 20:25274817-25274839 GGGGCTTGCTGCCTCCCTGGAGG + Intronic
1171457730 20:25281377-25281399 CTGCGCCCCTGCCTTCCTGGGGG + Intronic
1173555869 20:43965176-43965198 CTGGCTGGCTGTCTCCGTGGTGG + Intronic
1173644154 20:44623075-44623097 CTGGCTCTCCCCCTTCCAGGAGG - Exonic
1173791223 20:45828906-45828928 TTGGCACCCTGCCTGCCTGGGGG - Intronic
1174404488 20:50294605-50294627 CTGCCTGGATGGCTTCCTGGCGG + Intergenic
1174536485 20:51255249-51255271 CTGGGTCTCTGCTTTCCTGATGG + Intergenic
1174564204 20:51452940-51452962 GTGGCACGCAGCCCTCCTGGTGG + Intronic
1174657848 20:52186676-52186698 CTGGGCAGCTGGCTTCCTGGTGG + Intronic
1175195064 20:57237362-57237384 CTGGCTCGCTCTTTCCCTGGAGG + Intronic
1175769747 20:61616254-61616276 CTGCCTCGCTGCCTTCCCTCGGG + Intronic
1175876817 20:62234207-62234229 GTGGCTTCCTGCCTTGCTGGGGG - Intronic
1176292911 21:5055685-5055707 CTGGCCCTCTCCCTCCCTGGGGG - Intergenic
1178348307 21:31851068-31851090 CTGCCTGGCTGCCTCCCTGCTGG + Intergenic
1179266531 21:39808268-39808290 ATGGCTTGGTGCCTTCCTTGTGG + Intergenic
1179331638 21:40407996-40408018 AAGGCTCGCTGGCTACCTGGTGG + Intronic
1179864349 21:44207965-44207987 CTGGCCCTCTCCCTCCCTGGGGG + Intergenic
1180165207 21:46022216-46022238 CTTCCTCGCGGCCTTTCTGGAGG + Intergenic
1180878112 22:19184732-19184754 CTGTCTCACTGCCTTCCCAGAGG + Intronic
1181036437 22:20171870-20171892 CTGGCTCACCGCCCACCTGGAGG - Intergenic
1182115959 22:27756494-27756516 CTGCCCCGCTGCCTACCTGAGGG + Intronic
1183407608 22:37638225-37638247 CTGGCCAGCAGCCTTCCTGTTGG + Intronic
1183979968 22:41533621-41533643 CAGGGTCCCTGCCGTCCTGGGGG - Intronic
1184232396 22:43165565-43165587 CTGGCTCTTGGCCTTCCTTGGGG + Intergenic
1184316626 22:43698291-43698313 CTGGATCCCTGCCATCATGGAGG + Intronic
1184510776 22:44931998-44932020 CTGCCTTCCTTCCTTCCTGGGGG - Intronic
1184654683 22:45935167-45935189 CTGGCTCGCTGTCAGCCTGGAGG - Intronic
1184893079 22:47391350-47391372 CTGGCTCACTGCCCGCCTGGTGG - Intergenic
951404052 3:22272152-22272174 CTGGCTTGCTGCCTTCATTTTGG - Intronic
951780579 3:26358549-26358571 CTGGCTCCCAGACTTCATGGTGG - Intergenic
953095242 3:39768345-39768367 CTGGCTCCCAGTGTTCCTGGTGG + Intergenic
953795769 3:45984884-45984906 CTGGCTCTCTGCATTGGTGGAGG + Exonic
954082940 3:48223201-48223223 CTGGCTCTCTTCCTCTCTGGAGG + Intergenic
958133143 3:89455278-89455300 CTGGCTCATTCCCTTCCTGCAGG - Intronic
959756934 3:109910654-109910676 CTGGTTGGTTGCCTTCCAGGAGG + Intergenic
959875207 3:111373852-111373874 CTGGTTGGCTTCCTTTCTGGAGG - Intronic
960159466 3:114334262-114334284 CTTGCTCCCTGTCTTCCTAGGGG + Intergenic
961165423 3:124760197-124760219 CTGGGTCACTGCCTGCATGGAGG - Intergenic
961369386 3:126420179-126420201 TGGGCTGGCTGCCTTGCTGGGGG - Exonic
962888960 3:139654356-139654378 CTGGCTCTCTCTCTCCCTGGTGG - Intronic
963436151 3:145269389-145269411 CTGGCTTGCTGCCTGCATGCTGG - Intergenic
966390870 3:179451330-179451352 CGAGCTCGCCGCCTACCTGGAGG + Exonic
967876335 3:194270712-194270734 CTGGCTCGCTCCTTTCCTGCCGG + Intergenic
968084613 3:195868730-195868752 CTGCCTGACTGCCTTCCTGTTGG - Intronic
968121642 3:196130116-196130138 CAGGCTGCCTGCCTTTCTGGAGG + Intergenic
968172875 3:196524460-196524482 CTAGCTCTCAGCCTTCCTGTAGG + Intergenic
969670003 4:8584782-8584804 CTGGATCTCTGACTTCCTGTGGG - Intronic
973293369 4:48490855-48490877 CCGTCTCACCGCCTTCCTGGAGG + Exonic
975031757 4:69629201-69629223 CTGGCTCCCTTTCTACCTGGAGG - Intronic
978369479 4:108016089-108016111 TTAGCTGGCTGGCTTCCTGGTGG + Intronic
978398233 4:108305287-108305309 CTGCCTCCCTGCCTCCCTGAAGG - Intergenic
981419384 4:144532062-144532084 GTGGCTTGGTGCCCTCCTGGAGG + Intergenic
981723099 4:147821056-147821078 CTGGCTGGCTGGCTGGCTGGTGG + Intronic
982611415 4:157578513-157578535 CTGGCAAGGTGCCTTACTGGAGG - Intergenic
985516238 5:346279-346301 CAGGCTGGCTCCCTGCCTGGAGG - Intronic
985604823 5:852976-852998 CTGGCTCGCTGTCCTCCGTGGGG - Intronic
985604840 5:853040-853062 CTGGCTCGCTGTCCTCCGTGGGG - Intronic
985604848 5:853072-853094 CTGGCTCGCTGTCCTCCATGGGG - Intronic
985604866 5:853137-853159 CTGGCTCGCTGTCCTCCGTGGGG - Intronic
985604920 5:853361-853383 CTGGCTCGCTGTCCTCCGTGGGG - Intronic
985605324 5:854970-854992 CTGGCTCGCTGTCCTCCGTGGGG - Intronic
985715887 5:1461186-1461208 ATGGCTGGCTGCCTGCCTGGTGG - Intronic
986908192 5:12520514-12520536 ATGGCTTGGTGCCTTCCTTGTGG + Intergenic
987336961 5:16905535-16905557 CTGGCTGGCTGGCTGGCTGGTGG - Intronic
989198861 5:38743007-38743029 ATGGCTTGGTGCCTTCCTCGTGG + Intergenic
993387727 5:87279959-87279981 CAGGCTAGCAGCCTCCCTGGGGG - Intronic
993703118 5:91141961-91141983 CTGGGTTGGTGTCTTCCTGGCGG - Intronic
995242447 5:109900456-109900478 CTGGCCTGCTGCCTTCATGCTGG + Intergenic
997245522 5:132345210-132345232 CTGCCTTGCTGCCTTCTTGCAGG - Intergenic
997857260 5:137383495-137383517 CAGGCTGGCTGCATTCTTGGGGG - Intronic
998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG + Intergenic
998311592 5:141137483-141137505 CTCGCTCACTGTCTACCTGGTGG + Exonic
998316178 5:141184611-141184633 CTCGCTCACTGTCTACCTGGTGG + Exonic
998319002 5:141210959-141210981 CTCGCTCACTGTCTACCTGGTGG + Exonic
1001709250 5:173764653-173764675 CTGGCCCCCTGCCTACCAGGAGG + Intergenic
1004319383 6:14620860-14620882 GGGGCTTGCTGCCTTCCTGAGGG - Intergenic
1005232479 6:23719390-23719412 CATGCTTGCTGCCTGCCTGGAGG - Intergenic
1007214471 6:40226761-40226783 ATGGCTTGGTGCCTTCCTGATGG - Intergenic
1007698171 6:43747086-43747108 CTGGCCCTCTGGCATCCTGGGGG - Intergenic
1008765644 6:54910488-54910510 CTTGCTGCCTGCCTTTCTGGTGG + Intronic
1010501683 6:76609304-76609326 CTGGTCCTTTGCCTTCCTGGTGG + Intergenic
1010872953 6:81064274-81064296 CTGCCCCACTTCCTTCCTGGTGG - Intergenic
1015840489 6:137471646-137471668 CTGGCACCCTGCCTTCCAGCTGG + Intergenic
1016991646 6:149933847-149933869 CTGGCTTCATGCCTTCCTGCAGG + Intergenic
1017390731 6:153936513-153936535 TTGGCTCTCTGCCTGCCTGTTGG + Intergenic
1018045598 6:159963426-159963448 GTGGTTGGCTGCCTTCCTGCAGG - Intergenic
1018509663 6:164511566-164511588 GTGGCTCTCTGCTTTTCTGGAGG - Intergenic
1020975362 7:14999541-14999563 ATGGCTTGGTGCCTTCCTTGTGG + Intergenic
1021839957 7:24714306-24714328 CTCTCTCCCTACCTTCCTGGTGG - Intronic
1022210717 7:28206359-28206381 CTGGCTGGCTACCTTCATAGAGG + Intergenic
1022474020 7:30698691-30698713 GAGGGTCCCTGCCTTCCTGGGGG - Intronic
1022504163 7:30900213-30900235 CGGGCTGGCTGCCTTCTAGGTGG - Intergenic
1025175756 7:56801485-56801507 CGGTTTCACTGCCTTCCTGGTGG - Intergenic
1025211492 7:57021489-57021511 CTGGCTCGTTTCTCTCCTGGGGG - Intergenic
1025660463 7:63555358-63555380 CTGGCTCGTTTCTCTCCTGGGGG + Intergenic
1025696036 7:63774937-63774959 CGGTTTCACTGCCTTCCTGGTGG + Intergenic
1026052096 7:66955483-66955505 CTGGCTTGCTGTCTTCCAGGTGG + Exonic
1026873882 7:73869055-73869077 CAGGCCTGCTGCCTTTCTGGGGG + Intergenic
1026880331 7:73903544-73903566 CTGTCTCAGTGACTTCCTGGAGG + Intergenic
1027052732 7:75030014-75030036 CTGGCTGGCTTCCTTCCCTGGGG - Intronic
1030065171 7:105653822-105653844 CTGGCTCTGTGCCTTTCTGTGGG + Intronic
1032086151 7:128884901-128884923 CTGCCTCGCTGCCAGCCTGAAGG - Intronic
1034781894 7:153888336-153888358 CAGGCACGCGGCCCTCCTGGGGG - Intronic
1034971107 7:155419763-155419785 CTGGCTCATCGCCTCCCTGGTGG - Intergenic
1036442939 8:8797420-8797442 CTCGCTCGCTGCCGTTCTTGGGG + Exonic
1037291220 8:17351032-17351054 CTAGCTGGCTGACTTCATGGAGG - Intronic
1037314010 8:17583691-17583713 ATGGCTTGTTGCCCTCCTGGAGG + Intronic
1037876775 8:22552344-22552366 GGGGCTGGCTGCCTGCCTGGAGG + Intronic
1037881060 8:22573699-22573721 CTGGCACCCTGACTTCCTTGGGG - Intronic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1037904122 8:22705319-22705341 GTGTCTGGGTGCCTTCCTGGTGG + Intergenic
1040566340 8:48571221-48571243 CTGCCTCTCTGACCTCCTGGTGG + Intergenic
1041466125 8:58159274-58159296 CTCGCTGGCTGCCTTCTGGGAGG - Intronic
1044931048 8:97251888-97251910 CTGGCTGGCTGGCTGCATGGTGG + Intergenic
1045008002 8:97932684-97932706 CTGGCCCCCTGCCCTCCCGGAGG - Intronic
1049230138 8:141477643-141477665 CTGGTGCTCTGCCCTCCTGGTGG - Intergenic
1049284076 8:141765135-141765157 GTGACTCTCTGCCTTCCAGGAGG - Intergenic
1049534220 8:143170629-143170651 CTGGCTCTCTGGCATCCTGGGGG + Intergenic
1049647931 8:143744712-143744734 CAGGCTCACTGTCTTGCTGGAGG + Intergenic
1049663890 8:143834445-143834467 CAGGCTGCCTTCCTTCCTGGAGG - Exonic
1049877759 8:145036901-145036923 ATGGCTTGATGCCTTCCTGGAGG + Intergenic
1051427699 9:16950405-16950427 CTGGATAGCTGCATGCCTGGAGG + Intergenic
1051519383 9:17968236-17968258 GTGGCACAATGCCTTCCTGGAGG - Intergenic
1051839778 9:21382167-21382189 CTGGCTCTCAGCATTCCAGGAGG - Intergenic
1052403118 9:28025763-28025785 CTGGCTCTCTGCCTTCTGGATGG - Intronic
1053904273 9:42825712-42825734 CTGGGGCGCTGCCTCCCTGTTGG - Intergenic
1054366006 9:64342764-64342786 CTGGGGCGCTGCCTCCCTGTTGG - Intergenic
1054530711 9:66179802-66179824 CTGGGGCGCTGCCTCCCTGTTGG + Intergenic
1054673634 9:67832493-67832515 CTGGGGCGCTGCCTCCCTGTTGG - Intergenic
1059261903 9:112985147-112985169 CTGGCTCTCAGCCTTCCTTTTGG - Intergenic
1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG + Exonic
1060393669 9:123300603-123300625 TTGGATCCCTGCCTCCCTGGTGG - Intergenic
1060800845 9:126545171-126545193 CAGGCTGGCTGACTCCCTGGAGG + Intergenic
1061201500 9:129140893-129140915 GTGCCTGGCTGCCCTCCTGGAGG + Intronic
1061860372 9:133464847-133464869 CCAGCTCTCTGCCTCCCTGGTGG + Intronic
1062232999 9:135493059-135493081 CCGGCTCGCAGCCTTCCATGCGG + Intergenic
1062448554 9:136606011-136606033 CTGGCTCTCTGCCCTCCTCCCGG - Intergenic
1186359458 X:8824629-8824651 CTGGCCCCTTGACTTCCTGGAGG + Intergenic
1186363821 X:8871128-8871150 TTGGCTAGCTGACTTCCTGTTGG - Intergenic
1188093666 X:25994878-25994900 CTGGCTTGCTGCCTTCATGCTGG + Intergenic
1189704408 X:43745355-43745377 GTGTCTAGCTGCCTTCCAGGGGG - Exonic
1192585884 X:72317889-72317911 CTGGCTCGCTTGCTCACTGGTGG - Intergenic
1195001266 X:100645443-100645465 CTACCTCGCTGACTTCCTGCTGG + Intronic
1198171058 X:134105641-134105663 ATGGCTTGGTGCCATCCTGGTGG - Intergenic
1198757486 X:139996637-139996659 CTGGCTCACAGACTTCCTGAAGG - Intergenic
1200225881 X:154417272-154417294 ATGGCTCCCTGCCATCTTGGTGG - Intronic
1200231149 X:154444472-154444494 CTGGCTCGCTGACTTCCAGCAGG + Intronic