ID: 1059448910

View in Genome Browser
Species Human (GRCh38)
Location 9:114357806-114357828
Sequence GAGCAGCAAGTATTCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059448904_1059448910 14 Left 1059448904 9:114357769-114357791 CCTGCATGTCAGGTGGGATTGTG 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1059448910 9:114357806-114357828 GAGCAGCAAGTATTCCAAGAAGG 0: 1
1: 1
2: 0
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059448910 Original CRISPR GAGCAGCAAGTATTCCAAGA AGG Intronic
902256476 1:15192383-15192405 CTGGAGCAAGGATTCCAAGAAGG - Intronic
902859020 1:19231318-19231340 GAGAAGCAAGGACTGCAAGATGG + Exonic
906803147 1:48755006-48755028 TAACAGGAAGTATTCCAACATGG - Intronic
908389003 1:63668618-63668640 CAAGAGCAAGTATGCCAAGAGGG + Intergenic
908489354 1:64627526-64627548 GAGCATCATGAACTCCAAGAAGG - Intronic
909714485 1:78691477-78691499 GAGCAGAGAGGATTTCAAGAAGG + Intergenic
910612037 1:89155033-89155055 GAACAGCAAGTATTGCAGAATGG - Intronic
910700339 1:90067437-90067459 GGGCAGCAAGTATTCAAGAAAGG + Intergenic
910985025 1:92996935-92996957 GAGCAAAAAGAATTCCAAAAAGG - Intergenic
911831896 1:102560789-102560811 GAGCAGCTTGTGTTCCAAGTAGG - Intergenic
912337442 1:108876301-108876323 CAGCACCAAGTCTTCCAAAAAGG + Intronic
913079870 1:115373553-115373575 GAGGAGAAAGTATTTCAAGAAGG - Intergenic
915718293 1:157964776-157964798 GAGCAACTTGTATTCCAGGAAGG - Intergenic
917478204 1:175386877-175386899 GAGAAGCAAGTTTACCCAGAAGG - Intronic
917768925 1:178254685-178254707 GAGAAGAAAGAATTCCAACAAGG - Intronic
918128536 1:181605198-181605220 AAGCAGGAAGAGTTCCAAGATGG + Intronic
922014457 1:221630987-221631009 GTGCAGAAAGTGTTTCAAGATGG + Intergenic
923927274 1:238646347-238646369 AATCAGTAGGTATTCCAAGAGGG + Intergenic
924680489 1:246226785-246226807 GATATGCAAGTACTCCAAGAAGG + Intronic
1063720573 10:8576805-8576827 GAGCAGCTAGGATTACAAGTGGG + Intergenic
1065372919 10:25008524-25008546 AAGCAGAAAGTAGTCCAAGAAGG + Intronic
1065731569 10:28713947-28713969 GGGCAGCAAGTATCCCATGGGGG + Intergenic
1066020731 10:31298051-31298073 GTGCAGGAAGTATTTCAAGGAGG + Intergenic
1068874348 10:61980606-61980628 CAGCAGCTATTTTTCCAAGATGG - Intronic
1069342326 10:67426092-67426114 GATCAGCAAGAATTCCCAAATGG + Intronic
1070808455 10:79285019-79285041 AAGCCACAAGAATTCCAAGAAGG - Intronic
1071367592 10:84915453-84915475 CAGCAGAAAGTTTTCCAAAATGG - Intergenic
1073022311 10:100455274-100455296 GAACAGCAAGTATTGCAGAATGG - Intergenic
1073438182 10:103535157-103535179 CAGCAGCAAGTATCCCAGAAAGG + Intronic
1075104810 10:119531934-119531956 GGTCAGAAAGTATGCCAAGATGG + Intronic
1075214683 10:120521807-120521829 GAGCAGCAGCTATGCCAAAATGG + Intronic
1078848446 11:15142336-15142358 GAACTGCAAGTGTTTCAAGAAGG - Intronic
1079589762 11:22167849-22167871 GAGAAGAAAGTGTTTCAAGAAGG - Intergenic
1081027581 11:38035070-38035092 GCGAAGCAGGTATTTCAAGAAGG + Intergenic
1081613502 11:44577387-44577409 GAGGAGCAAGTCTTCCCTGAGGG - Intronic
1082189645 11:49227329-49227351 GTGAAGAAAGTATTTCAAGAAGG - Intergenic
1086612936 11:88778577-88778599 GAGCAGTGGGCATTCCAAGATGG - Intronic
1086942705 11:92814994-92815016 GAACATCATGTAGTCCAAGAGGG + Intronic
1087089048 11:94248867-94248889 GAACAGCAAATATTCCAGAATGG - Intergenic
1089492128 11:118890428-118890450 GAGAAGAGAGAATTCCAAGAGGG + Intronic
1089762438 11:120738171-120738193 GAGAAGAAAGTATTTCAAGATGG + Intronic
1091613047 12:2027897-2027919 GAGCAGCTTGTCTCCCAAGAGGG + Intronic
1092074121 12:5659221-5659243 GAGGAGGAAGTATTTTAAGAGGG - Intronic
1092992183 12:13913409-13913431 GAGAACCAACTATGCCAAGAGGG + Intronic
1093554107 12:20450088-20450110 GAGCAGCATCAAATCCAAGACGG - Intronic
1094831530 12:34302489-34302511 AAGCGGCAAGAATTCCTAGAAGG + Intergenic
1094836024 12:34322471-34322493 AAGCAGCAAGAAATCCAAGAAGG - Intergenic
1094837840 12:34330506-34330528 AAGCAGCAAGAATGCCCAGATGG - Intergenic
1098493098 12:71105085-71105107 GAGAAGCAAGTATTCCAAGAGGG - Intronic
1098563488 12:71904189-71904211 GTGAAGAAAGTATTTCAAGAAGG + Intronic
1098963400 12:76762532-76762554 GAGCAGCAGTTACTCAAAGAGGG - Intergenic
1099360482 12:81694366-81694388 GAGCAACCAGGATGCCAAGAAGG - Intronic
1101370973 12:104129992-104130014 GAGCTAAAAGAATTCCAAGAGGG + Intronic
1102241880 12:111329576-111329598 GTGCAGATAGTTTTCCAAGAGGG + Intronic
1106646239 13:31637733-31637755 GAGCAGCAAATATTGCAGAATGG + Intergenic
1106751848 13:32780613-32780635 GTGCATCAAGGATTTCAAGAAGG + Intergenic
1107380636 13:39853593-39853615 GAGCAGCAAATATTGCAGAATGG + Intergenic
1107782329 13:43917020-43917042 GTGCAGCAAGTAGTCCAAGGAGG - Intergenic
1117387344 14:55229198-55229220 GAGCAGCACCAAATCCAAGATGG + Intergenic
1117875435 14:60247158-60247180 GAGTATTAAGGATTCCAAGAAGG + Intronic
1118742230 14:68747959-68747981 GAGAAGAAAGTATTTCTAGAAGG - Intergenic
1118824448 14:69367609-69367631 GAGCTTCAAGAATTCCAAGCAGG + Intergenic
1119605611 14:76013658-76013680 GAGCAGCAACAAATCCAAAATGG + Intronic
1121086825 14:91153062-91153084 CAGAAGCAAGTATTTCAAGGAGG - Intronic
1121591482 14:95115794-95115816 GAGAAACAAGTGTTCCAAGTCGG - Exonic
1123099022 14:105783211-105783233 TGTCAGCAAGTATCCCAAGATGG + Intergenic
1125330979 15:38581534-38581556 GAGCAGCAAATATTGCAGAACGG - Intergenic
1128990765 15:72258050-72258072 GAGCAGCATGTCTTCCAAAATGG - Exonic
1132770158 16:1557637-1557659 TAGGAGCAATTATTCCCAGAGGG + Intronic
1136536060 16:30900215-30900237 GAGCAACAGTTATCCCAAGAGGG + Intronic
1136564233 16:31060635-31060657 GATCACCAAGAATCCCAAGAAGG + Intergenic
1136600489 16:31284035-31284057 GAACAGCAAATATTACAAAACGG + Intronic
1136743625 16:32562743-32562765 AACCAACAGGTATTCCAAGAAGG - Intergenic
1139076668 16:63458829-63458851 AAGCACCAAGTGTTCTAAGAAGG + Intergenic
1139621452 16:68147659-68147681 GAGCAACAGGTATACCAAAAAGG + Intronic
1140196131 16:72857071-72857093 GAGCTGGAAGAATTCCAAGCAGG - Intronic
1142330992 16:89453765-89453787 GAACAGGAAGTATTACATGAAGG + Intronic
1203025974 16_KI270728v1_random:512486-512508 AACCAACAGGTATTCCAAGAAGG + Intergenic
1203045747 16_KI270728v1_random:821945-821967 AACCAACAGGTATTCCAAGAAGG - Intergenic
1142677206 17:1521178-1521200 GGCCAGCAAGTTTTCCAAGGGGG + Intronic
1143272760 17:5688160-5688182 GAGCAGCAAGCTTTCCAAATTGG + Intergenic
1145737476 17:27243068-27243090 GAGAAGAAAGTATTCCAAGCAGG - Intergenic
1146664066 17:34685198-34685220 GTGCAGAAAGAAGTCCAAGAAGG - Intergenic
1149220049 17:54406685-54406707 GAATAGTGAGTATTCCAAGATGG + Intergenic
1149259379 17:54862352-54862374 GAGTAGAAAGAATTCTAAGAAGG + Intergenic
1151237007 17:72727958-72727980 GAAAAGGAACTATTCCAAGAAGG - Intronic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1153799186 18:8654291-8654313 GAGCAGCAGGTATTTGAAGCTGG - Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1156146281 18:34184616-34184638 GAACAGCAAGAATTCTGAGAAGG + Intronic
1156707993 18:39907170-39907192 GGAGAGCAAGCATTCCAAGATGG + Intergenic
1156859757 18:41822173-41822195 GAGCAGAAAGTATTCCAGTTTGG - Intergenic
1157079324 18:44505695-44505717 AAGCAGCAAAGATTGCAAGAAGG - Intergenic
1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG + Exonic
1166131962 19:40751007-40751029 GAGCAGCAAGTTTCCTCAGACGG - Exonic
1167476534 19:49704766-49704788 GAACAGCAACTATTACATGATGG + Exonic
1168125874 19:54282520-54282542 GAGAAGCAAGGATTACAATATGG + Intergenic
1168554273 19:57325146-57325168 GAGCAAGTAGTATTCCAAGTAGG + Intronic
925145244 2:1578354-1578376 GTGGAGCAAGTCTTCCAAAAGGG - Intergenic
926905274 2:17799682-17799704 GAGCAGCCTGTCTTCCAAGGAGG + Intronic
927807717 2:26162543-26162565 GAGCAGCAAGTCTACCCAGAAGG - Intergenic
931918451 2:66985478-66985500 AGGCAGCAAGTATGGCAAGAGGG + Intergenic
933293529 2:80464132-80464154 GATCAACTAGAATTCCAAGAGGG - Intronic
933476092 2:82792595-82792617 TGGCAGCAAGTATTTCATGAGGG - Intergenic
935174492 2:100637984-100638006 GAGAAGAGAGTATTTCAAGAAGG + Intergenic
935208238 2:100915214-100915236 GAGCAGCTACACTTCCAAGAGGG + Intronic
935757205 2:106285335-106285357 GAGCTGTTAGTATACCAAGAAGG + Intergenic
937748695 2:125447538-125447560 AAGCAGCAAATATTCAAAGAAGG + Intergenic
939317282 2:140567253-140567275 TAGCAGTAAGTAGTCCAAAATGG - Intronic
940263144 2:151806168-151806190 GAGATGAAAGTATTTCAAGAAGG - Intronic
940700931 2:157041927-157041949 GAAAAGCTAGGATTCCAAGAAGG + Intergenic
941791951 2:169561594-169561616 GAAAAGAAAGTATTCCCAGATGG + Intronic
941869273 2:170366786-170366808 GAGAAGCAAGGCTTCCAACACGG - Intronic
943649399 2:190441004-190441026 TAGCAGTAAGTATTATAAGAGGG + Intronic
944291536 2:198012421-198012443 GTGCAGAACGAATTCCAAGATGG - Intronic
946517807 2:220432236-220432258 GAGCAGCAACTGTACCATGATGG + Intergenic
947080304 2:226388531-226388553 GAGAAGAAAGTATCCTAAGAGGG - Intergenic
947513530 2:230781308-230781330 CAGCAGCACATATTTCAAGACGG - Intronic
947971593 2:234329384-234329406 GATCAGCGACTATTTCAAGAGGG - Intergenic
1169351815 20:4874060-4874082 GAGCAGCCAGGATACCAGGATGG + Exonic
1170507953 20:17047958-17047980 GAGCAGCCTGGATTCCAAGGAGG - Intergenic
1174569326 20:51490325-51490347 GAGAAGCCAGGATTCCAACACGG + Intronic
1175335889 20:58196057-58196079 GAATAGCAAGGATTTCAAGACGG - Intergenic
1178526242 21:33331631-33331653 CAGCAGCAAGTACTACAAAATGG - Intronic
1181256731 22:21567726-21567748 GAGCAGCACCAAATCCAAGATGG + Intronic
949553070 3:5128317-5128339 GAGAAGCTAGTCTTCCAATAAGG + Intronic
950327503 3:12125497-12125519 AAGCAGCAAGTATTGGAAGTTGG - Intronic
952073553 3:29669084-29669106 GAGCAGCAAGCCTACCCAGAGGG - Intronic
952191170 3:31024930-31024952 GAGAAGGAAGTAGTCCAACAAGG - Intergenic
953700291 3:45190413-45190435 CAGCAGCAATTCTTCAAAGATGG - Intergenic
953977786 3:47395377-47395399 CAGCAGCAAGTACTGCAACAGGG + Intronic
954700515 3:52448320-52448342 GAGCAGGAACCAATCCAAGATGG - Intergenic
954718286 3:52538151-52538173 GGGCAGAAAGGATACCAAGAAGG + Intronic
955253883 3:57309750-57309772 GAGGAGCAAGGACTCAAAGAGGG + Intronic
956510626 3:69989273-69989295 GAGCAGCAAAGATTACCAGAGGG - Intergenic
956657770 3:71568538-71568560 AAGTAGTAAGTATTTCAAGAAGG - Intronic
960421813 3:117455637-117455659 GCCCATCAAGTATTCCAACAAGG + Intergenic
963514625 3:146293210-146293232 GAACAGCAAATATTGCAAAATGG + Intergenic
970819990 4:20200397-20200419 GAGCAGCTAGGATTACAAGTGGG + Intergenic
971252723 4:24986656-24986678 GAACAGCAGGCATTCCAAGTGGG - Intergenic
971462791 4:26920175-26920197 CGGCAGCTAGTGTTCCAAGAGGG + Intronic
971538355 4:27783437-27783459 GACCAGAAAATATTTCAAGAAGG + Intergenic
977139861 4:93355489-93355511 CAAGAGCAAGTGTTCCAAGAGGG + Intronic
979880909 4:125959040-125959062 GTGCAGCAAGCATTGCCAGAAGG - Intergenic
979957552 4:126973273-126973295 GAGCAAGAAGTAGTTCAAGATGG + Intergenic
980386619 4:132093374-132093396 GAGCCTCAAATATTCTAAGATGG - Intergenic
980503904 4:133690502-133690524 GAGCAGCAAATATTGCAGAATGG + Intergenic
981771464 4:148314199-148314221 GATGAGCAAGTATGACAAGAGGG + Intronic
983965607 4:173806228-173806250 GAGCAGAAATTATGCCATGAGGG - Intergenic
984684506 4:182651143-182651165 CAGCAATAAATATTCCAAGAGGG - Intronic
987152384 5:15056160-15056182 TGGCAGCAAGTACTCCAGGATGG + Intergenic
992866649 5:80962957-80962979 GAGAAGCAAGCATTCCAGAATGG + Intronic
993742320 5:91556196-91556218 GAACAGCAAATATTGCAAAACGG - Intergenic
993888357 5:93442874-93442896 GAGCAGCAAATATTGCAAAACGG - Intergenic
994861254 5:105198694-105198716 GAACAGCAAATATTGCAAAACGG - Intergenic
995235103 5:109820033-109820055 GAGCAGCAAGTGGTCAATGAAGG - Intronic
995701141 5:114937362-114937384 AAGAAACAAGTACTCCAAGAAGG + Intergenic
995813900 5:116144595-116144617 GAGAAGGAAATATTTCAAGATGG + Intronic
1004123823 6:12852754-12852776 GCTCAGAAAGTATTCAAAGAGGG + Intronic
1005393409 6:25356498-25356520 GAGCAGCAAGGATTCTAGGTGGG + Intronic
1005656297 6:27941695-27941717 GAGCAGAAAGTGTTTCCAGAAGG + Intergenic
1007200854 6:40107483-40107505 GACCAGCAAGTACTGGAAGATGG + Intergenic
1007698864 6:43752921-43752943 CAGCACCCAGTATTCCAAGGTGG - Intergenic
1008044225 6:46835329-46835351 GAGCAGCAGGTCTCCGAAGAAGG + Exonic
1012271652 6:97219813-97219835 GAGGAGCCAGTATTCCAGGCAGG - Intronic
1013402504 6:109812558-109812580 GAGAAGAAAGTGTTTCAAGAAGG + Intronic
1013989513 6:116237226-116237248 GAGGAGCAAGGATTCCAAGCAGG + Intronic
1014633833 6:123820178-123820200 AAGCAGAAAGTATTAAAAGAAGG + Intronic
1015985843 6:138883393-138883415 GAGCAGCAAGTGGTACATGAGGG - Intronic
1016724016 6:147339347-147339369 AAGCAGAAAGTTTTCCAAGATGG + Exonic
1018962562 6:168458769-168458791 GTGCAGAAAGTGTTCCTAGAAGG - Intronic
1021773777 7:24031314-24031336 GTGAAGGAAATATTCCAAGAAGG + Intergenic
1023150803 7:37199814-37199836 GATCTGCAAGTATTCTAAGTGGG + Intronic
1023263855 7:38384796-38384818 GGGCAACAAGTACTGCAAGAAGG - Exonic
1023714669 7:43030975-43030997 GATAGGCAAGTATTCCAAGAGGG + Intergenic
1024353512 7:48392058-48392080 GAGCAGCAAATGTTCCCGGACGG - Exonic
1026050740 7:66944409-66944431 GAGCAGCAACGATTTCAAAAAGG - Intronic
1027929169 7:84508819-84508841 GAGCAGGAAGTTTTCAGAGAAGG + Intergenic
1028114422 7:86981654-86981676 GGGAAGTAAGTATTCCCAGAAGG - Intronic
1029605390 7:101596126-101596148 CAAGAGCAAGTGTTCCAAGAGGG - Intergenic
1030740806 7:113107324-113107346 AAGAAGCAAGTTTTCCAACATGG - Intergenic
1033532576 7:142280057-142280079 GTGAAGCAAGTATGCCAAGAGGG + Intergenic
1033830776 7:145249875-145249897 GATCAGCCAGAATGCCAAGATGG + Intergenic
1038676885 8:29630927-29630949 GAGCAGCAAATCTTAAAAGAAGG + Intergenic
1039306809 8:36272215-36272237 GAGCAGAAAGTGTTAGAAGAAGG + Intergenic
1039951196 8:42174096-42174118 GAGTAGAAAGTAGTCTAAGAGGG + Intergenic
1041566994 8:59289871-59289893 GAGTGTCAAGTATTCCAATAAGG - Intergenic
1041858282 8:62482592-62482614 GACCAGCAAGTCTTCCAAAATGG + Intronic
1042192641 8:66203218-66203240 GAGCAGCCAGCATCCCAGGAGGG - Intergenic
1047302355 8:123624545-123624567 TAGCAGAAAGTCTTCAAAGATGG - Intergenic
1048521186 8:135156953-135156975 GAACAGCAAATATTGCAAAACGG + Intergenic
1053653373 9:40191662-40191684 GAGCAGCAGGTCTCCAAAGAAGG - Intergenic
1054531211 9:66184556-66184578 GAGCAGCAGGTCTCCAAAGAAGG + Intergenic
1054920210 9:70536033-70536055 GAGAAGCAAGTCCTCCAAGCCGG - Exonic
1055931925 9:81567660-81567682 GAGTTTCAAGTATTCCAAAATGG + Intergenic
1056293526 9:85168440-85168462 GAGCAGCAAGTTAGCTAAGAAGG + Intergenic
1056694539 9:88835220-88835242 GACCAGGAAGGATTCCAGGAAGG + Intergenic
1056911266 9:90703026-90703048 GTGCAGCAAGTCTTTCAAAAGGG + Intergenic
1058812751 9:108657065-108657087 GAGCAGCAGGAATTCCAAAAAGG + Intergenic
1059448910 9:114357806-114357828 GAGCAGCAAGTATTCCAAGAAGG + Intronic
1059610876 9:115892443-115892465 GGGCAGGAAGTATTACAATATGG + Intergenic
1187477411 X:19624311-19624333 GAAAAAAAAGTATTCCAAGATGG + Intronic
1187819897 X:23276333-23276355 GTGCGGCAAGAAATCCAAGAAGG + Intergenic
1188032520 X:25280726-25280748 TAGCAGCAAGCAGTCTAAGAAGG + Intergenic
1188467305 X:30496425-30496447 GAGCAGCAAGTTTCCCTAGAAGG - Intergenic
1191840335 X:65509250-65509272 GAACAACTAGAATTCCAAGACGG + Intergenic
1195415128 X:104611539-104611561 TAGCAGCAAGAATTTCAAGCCGG + Intronic
1195459892 X:105112845-105112867 GGGCAGCAAGTATTCCTCCAGGG + Intronic
1195752826 X:108174941-108174963 TGGCAGCAAGGAATCCAAGAAGG - Intronic
1197688113 X:129465874-129465896 GAGAAGCAAGAATTCAACGAAGG - Exonic
1198213764 X:134538042-134538064 GAGTTGGAAGTATGCCAAGAGGG - Intergenic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1199677659 X:150201320-150201342 GAGCAGGAAGAGTCCCAAGATGG + Intergenic
1199975174 X:152890725-152890747 GAGAAGCAAGTTTTTCCAGAAGG + Intergenic
1200179007 X:154139125-154139147 GACCAGCAAGGATATCAAGATGG - Intergenic