ID: 1059449402

View in Genome Browser
Species Human (GRCh38)
Location 9:114360944-114360966
Sequence AGGGAGACACGGATGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059449402_1059449405 -8 Left 1059449402 9:114360944-114360966 CCTGGAGCCATCCGTGTCTCCCT 0: 1
1: 0
2: 1
3: 21
4: 205
Right 1059449405 9:114360959-114360981 GTCTCCCTTCCTCCCTCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059449402 Original CRISPR AGGGAGACACGGATGGCTCC AGG (reversed) Intronic
900400953 1:2472669-2472691 AGGGAGACACGGGTGGGCCCAGG + Intronic
900645920 1:3708736-3708758 GGGGAGACCCGGAGGGCTCTTGG - Intronic
902570788 1:17345939-17345961 AGGGACACACAGGTGGCTCAGGG - Intronic
902782964 1:18716409-18716431 AGGGAGGCACGAATGGCTGGAGG - Intronic
903026461 1:20433127-20433149 AGGGAGGCAGGGAAAGCTCCAGG - Intergenic
903424493 1:23243887-23243909 GGGGAGGCACGGGAGGCTCCTGG + Intergenic
904804133 1:33119139-33119161 AGAGAGACAAGGATGGATCCAGG + Intronic
904840166 1:33367494-33367516 AGGGAGAGAGGGATGGATCCAGG + Intronic
906117715 1:43367209-43367231 GGGCTGACACGCATGGCTCCCGG + Intronic
907340938 1:53735936-53735958 AGGGAGAAAGGGAAGGCTCAGGG - Intergenic
907550156 1:55298386-55298408 AGGGACACACAGAGGGCTCTGGG + Intergenic
908139964 1:61174030-61174052 ATGGAGACAAGGATGGCTTTTGG + Intronic
910541193 1:88359867-88359889 AAGGAGACATGATTGGCTCCAGG + Intergenic
914341629 1:146764979-146765001 AGGCAGACAGCCATGGCTCCGGG + Intergenic
918299068 1:183185962-183185984 CGGGAGAGAAGGAGGGCTCCGGG + Intergenic
918365832 1:183806825-183806847 AGAGAGACAAGGGTGGCTTCTGG - Intronic
918803377 1:189002837-189002859 AGGAAGAAATGAATGGCTCCGGG - Intergenic
919667961 1:200310633-200310655 GGGGAGACGCAGATGGCCCCTGG - Intergenic
920032184 1:203044137-203044159 AGGGATACATGGGAGGCTCCAGG - Intronic
922416595 1:225427969-225427991 GCGGTGACACGGACGGCTCCCGG + Intronic
922770699 1:228181419-228181441 GGTGAGACAGGGACGGCTCCAGG - Exonic
924573932 1:245261930-245261952 TGGGAGATACCGATGGCCCCTGG + Intronic
1062996549 10:1871803-1871825 AGAGAGAGAGGGAAGGCTCCAGG + Intergenic
1063006953 10:1981215-1981237 AGGAAGACACAGAGGGCTGCAGG - Intergenic
1064922490 10:20533616-20533638 AGGGAGAGACGGGTGCCTGCAGG - Intergenic
1065920623 10:30389329-30389351 AGGGAGAAAGGGATGCCTCCTGG + Intergenic
1071221353 10:83468809-83468831 GGGGAGACGGGGATGGCTCATGG + Intergenic
1072121010 10:92405622-92405644 AGGGAGACAAGGGTGGCCCCTGG - Intergenic
1072744432 10:97929893-97929915 AGCAAGACAGTGATGGCTCCAGG + Intronic
1075050334 10:119178705-119178727 GTGGAGACACTGGTGGCTCCGGG - Intronic
1075654206 10:124150729-124150751 GGGGAGCCAGGGAAGGCTCCGGG + Intergenic
1077472640 11:2771193-2771215 ATGCAGACCCTGATGGCTCCTGG + Intronic
1080014379 11:27489351-27489373 AGGGAGATAGGGATGGTTTCAGG + Intergenic
1083624940 11:64067566-64067588 AGGGAGACAAGCCTGGGTCCTGG - Intronic
1084559277 11:69893634-69893656 AGGGACACACGGATCGGTCTTGG + Intergenic
1085181002 11:74535976-74535998 ATGGAGTCACAGCTGGCTCCAGG + Intronic
1096262203 12:50099909-50099931 AGGAAGACAGGGATGGCCCAGGG - Exonic
1098052547 12:66469963-66469985 ATGGAGCCAGGGATGGCTCCTGG - Intronic
1102210449 12:111123075-111123097 CCAGAGACACGGAAGGCTCCTGG - Intronic
1103207740 12:119143569-119143591 AGAGAGAAAGGGATGGTTCCAGG - Intronic
1104002587 12:124869482-124869504 AAGGAGGCACAGCTGGCTCCTGG + Intronic
1104382203 12:128316840-128316862 AGTGAGTCACAGATGGCCCCAGG - Intronic
1105203092 13:18195436-18195458 AGGGAGACCCAGAGGGTTCCAGG - Intergenic
1108459278 13:50649025-50649047 AGGGAGGCAAGGATGGGTGCAGG + Intronic
1111134573 13:84024529-84024551 AAGGAGACAGGGATGGATACCGG + Intergenic
1111364415 13:87223489-87223511 AGGAAGACCAGGTTGGCTCCTGG + Intergenic
1114934404 14:27515561-27515583 AGGGAGACACTGCTGCCTGCTGG - Intergenic
1115499587 14:34037448-34037470 GAGGAGACAGGGAAGGCTCCTGG - Intronic
1117729976 14:58712596-58712618 TGGGAGGCACGGAAGGCTTCAGG + Intergenic
1119489317 14:75017096-75017118 AGGGAGGCATGGATTGCTGCAGG + Exonic
1119525644 14:75320461-75320483 ACGGTGACACAGCTGGCTCCGGG - Intergenic
1120521700 14:85533164-85533186 AGGGAGAGAAAGAGGGCTCCAGG + Intronic
1121671132 14:95711588-95711610 AGGGAGACATGAGTGCCTCCAGG + Intronic
1121818914 14:96950064-96950086 AGGGAGACACAGAAGAATCCAGG + Intergenic
1121917592 14:97850386-97850408 AGGGAGAGATGGATGGATGCTGG - Intergenic
1126457363 15:48878287-48878309 AGGGACGCAGGGATAGCTCCCGG - Exonic
1128556918 15:68638096-68638118 AGGGAGACCAGGATGGCCCTGGG + Intronic
1129405030 15:75311291-75311313 AGGGAGAGAGGGAAGCCTCCAGG - Intergenic
1129478692 15:75806168-75806190 AGGGAGAAAGGGAAGCCTCCAGG - Intergenic
1129685080 15:77681362-77681384 AGGGATGCAAGGATGGCTCCTGG + Intronic
1129724934 15:77896879-77896901 AGGGAGACATTGGTGGCCCCTGG - Intergenic
1129836824 15:78713695-78713717 AGGGAGAGAGGGAAGCCTCCAGG - Intronic
1129856020 15:78825863-78825885 AGGGAGACAGGCCTGGCTCAGGG - Intronic
1130584521 15:85170758-85170780 AGGGAGAGAGGGAAGCCTCCAGG - Intergenic
1131558500 15:93419668-93419690 AAGAAGACACAGGTGGCTCCAGG + Intergenic
1134307533 16:13046620-13046642 AGGGAGCCATGGATGGCTTTAGG - Intronic
1134506938 16:14815385-14815407 AGTAATACACGGATGGATCCAGG + Intronic
1134573624 16:15313436-15313458 AGTAATACACGGATGGATCCAGG - Intergenic
1136008358 16:27346530-27346552 AGGGGGATACGGGTTGCTCCAGG - Exonic
1136110035 16:28059029-28059051 TGGGAGACACGGGTGGCTGTGGG + Intronic
1138099980 16:54244573-54244595 AGGGACACACAGATGTCTCCAGG + Intergenic
1138909272 16:61376732-61376754 AGGGAGATAGGGATGACTCTGGG + Intergenic
1139992649 16:70952463-70952485 AGGCAGACAGCCATGGCTCCGGG - Exonic
1141884191 16:86880490-86880512 AGGGAGACAAGGATGTCGCGAGG + Intergenic
1141950809 16:87338360-87338382 AGGGTGACAAGGATGCCTGCTGG + Intronic
1142494462 17:299044-299066 AGGGAGCCACTGAAGGCTTCGGG + Intronic
1142862467 17:2771198-2771220 AAGAAGGCACGGCTGGCTCCAGG - Intergenic
1143635499 17:8162105-8162127 AGGGAGACAGGGATGGGGCATGG + Intronic
1145830553 17:27912884-27912906 GGAGAGTCAGGGATGGCTCCTGG - Intergenic
1146626060 17:34436355-34436377 AGGGAGACACAGATGACAGCAGG + Intergenic
1150264941 17:63826331-63826353 AGGGGGAAAAGGATGGCTCTAGG - Intronic
1151876637 17:76870714-76870736 AGGGACTCACTGATGGCTGCGGG - Intronic
1152284593 17:79404718-79404740 AGGGAGCCATGGATGGTTCTTGG - Intronic
1152607539 17:81300308-81300330 AGGGACACACGGAAGGACCCAGG - Intergenic
1152726192 17:81947627-81947649 TGGGAGACACGGCTGACTCCAGG - Intergenic
1152904794 17:82964598-82964620 ACGGAGACATGGATGCCTGCAGG + Intronic
1152904955 17:82965085-82965107 ACGGGGACACGGATGCCTGCAGG + Intronic
1153981236 18:10312433-10312455 GGAGAGACAGGGAGGGCTCCAGG - Intergenic
1155329799 18:24703571-24703593 ATGGTGACACAGTTGGCTCCTGG - Intergenic
1157166982 18:45366675-45366697 AGGGATTCACGCATGGGTCCTGG - Intronic
1157399275 18:47373527-47373549 AGGGAGACAAGGATGGCTGCTGG - Intergenic
1157433143 18:47646590-47646612 AAGGAGAGACGGATGACTTCTGG + Intergenic
1160833428 19:1113664-1113686 AGAGAGACCCGCATGGCCCCGGG - Exonic
1161243310 19:3234971-3234993 TGGGAGCCACGGAGGGCTGCAGG - Intronic
1161310825 19:3593093-3593115 TGGGAGAGACGGCTGGCTTCTGG - Exonic
1161994181 19:7702410-7702432 GGGGAGCCACGGAAGGCTCTAGG + Intergenic
1162157991 19:8692823-8692845 AGAGAGAGGTGGATGGCTCCAGG + Intergenic
1162588643 19:11576918-11576940 AGGGAGACACTGAATGCTCCCGG + Intronic
1163765120 19:19159532-19159554 ATGGAGACAGGGGTGGCACCTGG + Intronic
1166578395 19:43867049-43867071 ACGGAGTGACGGATGGCACCTGG - Intergenic
1167613703 19:50519424-50519446 AGGGAGACACGGATCAGTCACGG + Intronic
926280809 2:11444214-11444236 AAGGAAACACGGATCGCTCAAGG + Intergenic
926605853 2:14897867-14897889 AGAGGGACACGGTTGGCTCCTGG + Intergenic
928194033 2:29201411-29201433 ACGGAGTCAAGGATGACTCCTGG - Intronic
928996914 2:37302851-37302873 AGGCAGACAGGGGTGGGTCCTGG + Intronic
929188816 2:39121138-39121160 AGAGAGACAGGGAGGGCGCCCGG + Intronic
929546404 2:42857586-42857608 AGTGAGACACGGACGGGTGCAGG - Intergenic
932094943 2:68839241-68839263 AGGGAGCCATGGATGCCTCCAGG - Intergenic
932299445 2:70655844-70655866 AGGGAGAAACTGATGGCTTTGGG + Intronic
932322379 2:70831671-70831693 AGGCTGGCACGGAGGGCTCCAGG + Intronic
934991870 2:98927257-98927279 AGGGAGTCATTGGTGGCTCCAGG - Intronic
935198071 2:100832271-100832293 AGGGAGATACAGGTGGCTCAGGG - Intronic
935981556 2:108633030-108633052 GGGGATACACGGATGCTTCCTGG - Intronic
936243196 2:110805847-110805869 AGGGAGGCAGAGATGGCTCCTGG - Intronic
936282254 2:111152325-111152347 AGGGAGACACTGTGGGCACCAGG - Intronic
937866449 2:126754712-126754734 GGTGAGACAAGGATGTCTCCTGG - Intergenic
938290108 2:130144557-130144579 AGGGAGACCCGCGTGGCCCCCGG - Intronic
938466421 2:131528388-131528410 AGGGAGACCCGCGTGGCCCCCGG + Intronic
947913576 2:233818164-233818186 AGGGAGAGAGGGCTGACTCCAGG + Intronic
948063562 2:235060310-235060332 AGGGAGAAAGAGATGGTTCCTGG + Intergenic
948336394 2:237210792-237210814 AGGGAGACACGAAGGGCTGGAGG + Intergenic
948382973 2:237563936-237563958 AGGCAGAGACGGCTGGCCCCTGG + Intergenic
1168771759 20:420562-420584 AGGTAGCCACGGAAGGCGCCAGG - Intronic
1171113149 20:22502304-22502326 AGGGAGCCAGGGAATGCTCCAGG - Intergenic
1172944160 20:38674829-38674851 ATGAAGGAACGGATGGCTCCGGG - Intergenic
1173303762 20:41828669-41828691 AGGCAGACAGAGATGGGTCCTGG + Intergenic
1173968634 20:47133195-47133217 AGGGTGACAGAGATGGCTGCCGG + Intronic
1176100642 20:63362934-63362956 TGGCAGACACCCATGGCTCCAGG - Intronic
1176274153 20:64254420-64254442 AGAGAGTCAAGGATGACTCCAGG + Intergenic
1176714868 21:10342569-10342591 AGGGAGACCCAGAGGGTTCCAGG + Intergenic
1177137965 21:17327365-17327387 ACTGAGACAGGCATGGCTCCAGG - Intergenic
1179176440 21:39011268-39011290 ATGGAGCCAAGGATGGCACCAGG + Intergenic
1179650792 21:42807251-42807273 AGAGAGAGAAGGCTGGCTCCCGG + Intergenic
1180080992 21:45487445-45487467 AGGATGACATGGAAGGCTCCGGG + Exonic
1180603480 22:17037369-17037391 AGGGAGACCCAGAGGGTTCCAGG - Intergenic
1182451104 22:30422427-30422449 AGGGAGACACTGAGGGGGCCAGG - Exonic
1183057331 22:35315037-35315059 AGGGAGACACGGAAGGATTTGGG + Intronic
1183431605 22:37769207-37769229 GGGGGGACACGGGTGGGTCCCGG + Intronic
1183464516 22:37973001-37973023 TGGGAGACACGGCCAGCTCCGGG + Exonic
1184103122 22:42351996-42352018 AGGGAGCCCAGGATGGCACCAGG + Intergenic
1184278091 22:43421719-43421741 AGGGAGAAACGGATGGATGGAGG - Intronic
1184609490 22:45593702-45593724 GGGGAGCCACTGAAGGCTCCGGG - Intronic
1184631420 22:45783558-45783580 AGGGAAACACGAAGGGCTGCAGG - Intronic
1185289085 22:50015069-50015091 ACGGAGACGCGCGTGGCTCCGGG + Intergenic
949366371 3:3285895-3285917 AGGGAGGCACAGCTGGCTTCAGG + Intergenic
950463421 3:13138995-13139017 AGGCAGACACTGAGGGCTCCCGG - Intergenic
950992836 3:17459257-17459279 AGGGGCACAGGGATGGCTTCAGG + Intronic
952923855 3:38307466-38307488 AGGGACCCATGGATGGCTCAGGG + Intronic
955928927 3:64036422-64036444 AGGGAGATATGGATGCCTACAGG + Intergenic
961439224 3:126942676-126942698 TGGGAGAAACGGCTGACTCCAGG - Intronic
961445046 3:126976494-126976516 AGGAAGCCAAGGAGGGCTCCTGG + Intergenic
961486154 3:127218184-127218206 AGGGAGATAAGAATGGCTCAGGG - Intergenic
962756284 3:138467750-138467772 GGTGAGGCACAGATGGCTCCAGG + Intronic
965178552 3:165367983-165368005 AGGCAGACAGCGATGGGTCCTGG - Intergenic
966838572 3:184069019-184069041 AGGCAGACAGGGATGGTCCCTGG + Intergenic
966917382 3:184592582-184592604 GGGCAGGCAGGGATGGCTCCTGG + Intronic
967303190 3:188036965-188036987 AAGGACACACTGATGTCTCCAGG + Intergenic
967389987 3:188946403-188946425 GGGGAGACATAGATGGGTCCAGG + Intergenic
968624920 4:1622740-1622762 AGGGAGGCAGAGATGGCTGCGGG - Intronic
969028182 4:4191132-4191154 AGGGAGATAAGGATGACACCTGG - Intronic
978412698 4:108442639-108442661 GGGGAGAGACGGTTGGCTCCTGG - Intergenic
981018902 4:140004667-140004689 AGGGAGACAATGACGGCTCCAGG + Intronic
981771268 4:148311426-148311448 AGAGAGAAAAAGATGGCTCCGGG - Intronic
984307579 4:178015272-178015294 AGGGGGTGACGGATGGCACCTGG + Intergenic
994104159 5:95927207-95927229 AGGGAGAAATGGATGGATCTGGG + Intronic
995344201 5:111092679-111092701 AGGGAGAACCGGACTGCTCCAGG - Intronic
996583769 5:125062137-125062159 AGGGAGCCTCTGATAGCTCCAGG + Intergenic
997470234 5:134113438-134113460 AGGGAGGCACGGCTGTCTTCCGG + Intergenic
997475331 5:134139280-134139302 AGGGAGACAGGGCTGGGACCAGG - Intronic
997785190 5:136704262-136704284 AGGGAGACTCTCTTGGCTCCAGG - Intergenic
998891627 5:146752248-146752270 AAGGAGTCAAGGATGACTCCAGG + Intronic
1001747547 5:174103325-174103347 AGGGAGTCATGGATGACTTCAGG + Intronic
1002019725 5:176355491-176355513 AGGGAGCCACTGAAGGCTTCTGG + Intronic
1002103827 5:176870153-176870175 AGGGAGGCGCGGATGACGCCAGG - Intronic
1002635940 5:180608853-180608875 AGGGAGCCACGAAAGGTTCCGGG + Intronic
1002658817 5:180775930-180775952 AGGGAGGCAGGGATGGCTCTTGG + Intergenic
1002804357 6:558025-558047 AGCGAGACATGGAAGGCTCAAGG + Intronic
1003539302 6:7004079-7004101 AGGGAGAAACGCAGGGCTCCTGG - Intergenic
1005965771 6:30725445-30725467 AGGGAAACACGGCTGGCTGATGG + Intergenic
1006115340 6:31773241-31773263 TGGGAGACAGGGATTTCTCCAGG - Exonic
1013044880 6:106475423-106475445 AGGTAGTCAGGGAGGGCTCCTGG + Intergenic
1014629685 6:123773314-123773336 AGGGACACATGGAGGGCTCTGGG - Intergenic
1016813293 6:148281471-148281493 AGTCAGACAGGGAGGGCTCCAGG + Intronic
1017463824 6:154676132-154676154 AGGGATACAAGGAGGGCTCATGG + Intergenic
1018909028 6:168091389-168091411 GGGGAGACAGAGATGGCTCTGGG - Intergenic
1019978484 7:4603403-4603425 AGGGAGACAAGGCTGGCTGGTGG - Intergenic
1022327706 7:29347026-29347048 ATGGAGACACAGAACGCTCCTGG - Intronic
1022342901 7:29485783-29485805 CAGGAGACTCTGATGGCTCCAGG - Intronic
1022421270 7:30225962-30225984 AGGGAGACAGGCAGGGCTCTTGG + Intergenic
1023697028 7:42857822-42857844 TAGGAGACAGGGATTGCTCCAGG - Intergenic
1026154052 7:67812066-67812088 AGGGAGACATGGCTAGGTCCTGG + Intergenic
1027228172 7:76257884-76257906 AGAGGGACACGGCAGGCTCCAGG + Intronic
1028381008 7:90198388-90198410 AGGGAGACAAGGATGGAAGCAGG - Intronic
1029374688 7:100170586-100170608 AGGGAGACACAGGTGGATGCCGG + Intronic
1029514501 7:101017243-101017265 CGGGAGACAGGGCTGGCTCTGGG - Intronic
1030259131 7:107544037-107544059 AGGAAGACCCTCATGGCTCCAGG + Intronic
1030732154 7:113003123-113003145 AGGGAATCAGGGATGACTCCTGG - Intergenic
1030871536 7:114762313-114762335 AGAGAGACACAGGTGGATCCTGG - Intergenic
1031538241 7:122961173-122961195 AGGGAGACACAGAAGTTTCCTGG + Intergenic
1033425964 7:141244520-141244542 ATGAACAAACGGATGGCTCCAGG + Intronic
1033598221 7:142871269-142871291 AGGGAGACAGGAACGGCTCTGGG - Exonic
1033636645 7:143218156-143218178 AGGGAGAGACGGGTGTCTCAGGG + Intergenic
1035988931 8:4466210-4466232 AGTGAGACAGGGATCTCTCCTGG + Intronic
1036422163 8:8607351-8607373 AGGGAGATAGGGATGGCTAATGG - Intergenic
1040663627 8:49604523-49604545 AGGCAGACAGGGGTGGGTCCTGG + Intergenic
1041207684 8:55514609-55514631 AGGGAAACACGGATGGAGACAGG - Intronic
1041317359 8:56578447-56578469 AGGGAGCCACGAATGTCTCTAGG - Intergenic
1041754671 8:61300857-61300879 GGGCAGTCAAGGATGGCTCCTGG - Intronic
1043392444 8:79804711-79804733 AGGGAGATACAGGTGACTCCTGG + Intergenic
1046171403 8:110512273-110512295 AGGGATAAACGAATGGCTCCTGG + Intergenic
1049071268 8:140357702-140357724 CAGGAGACACGGGTGGCTCTGGG + Intronic
1049470004 8:142771001-142771023 AGGGAGACAGGCAGGGCTCCTGG - Intronic
1049540718 8:143207638-143207660 AGGGAGACACAGTTGGTCCCAGG - Intergenic
1052906604 9:33840231-33840253 TGGAACACATGGATGGCTCCTGG - Intronic
1057211705 9:93204158-93204180 AGGGAGCCACTGAAGGCTCCTGG + Intronic
1057477082 9:95411917-95411939 AGGAAGTCAGGGAGGGCTCCAGG + Intergenic
1059249611 9:112876953-112876975 AGGGAGACAAGGAGGACTCAGGG + Intronic
1059449402 9:114360944-114360966 AGGGAGACACGGATGGCTCCAGG - Intronic
1059752461 9:117260725-117260747 AGAGAGAAATAGATGGCTCCAGG - Intronic
1060913423 9:127369307-127369329 AGGAAGGCACTGATGGGTCCAGG - Intronic
1061045653 9:128163633-128163655 AGGGAGGCAGGGTTGGGTCCCGG - Exonic
1061478312 9:130883979-130884001 ATGGAGACACGGCAGGCTCATGG - Exonic
1186250301 X:7658787-7658809 AGGGAGAAACTGATGGGCCCAGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1187958021 X:24539641-24539663 CGGGAGAGACGGAGGGCTCTGGG - Exonic
1193080868 X:77404767-77404789 AGGGAGACACTGCTGGGGCCAGG - Intergenic
1196173150 X:112611939-112611961 TGGAAGACACAGATGGCCCCAGG - Intergenic
1197887434 X:131233270-131233292 TGGGAGACAAGGATGACTCTAGG + Intergenic