ID: 1059450220

View in Genome Browser
Species Human (GRCh38)
Location 9:114366976-114366998
Sequence TCACTTCTGTTTTCAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059450214_1059450220 5 Left 1059450214 9:114366948-114366970 CCCTTACTTCCTCTCTGCCCCAG 0: 1
1: 0
2: 4
3: 62
4: 578
Right 1059450220 9:114366976-114366998 TCACTTCTGTTTTCAGAATGTGG No data
1059450215_1059450220 4 Left 1059450215 9:114366949-114366971 CCTTACTTCCTCTCTGCCCCAGT 0: 1
1: 0
2: 5
3: 51
4: 524
Right 1059450220 9:114366976-114366998 TCACTTCTGTTTTCAGAATGTGG No data
1059450213_1059450220 27 Left 1059450213 9:114366926-114366948 CCACGTATTTTATTTTTTTCTAC 0: 1
1: 0
2: 6
3: 89
4: 1020
Right 1059450220 9:114366976-114366998 TCACTTCTGTTTTCAGAATGTGG No data
1059450216_1059450220 -4 Left 1059450216 9:114366957-114366979 CCTCTCTGCCCCAGTTTTCTCAC 0: 1
1: 3
2: 20
3: 201
4: 1076
Right 1059450220 9:114366976-114366998 TCACTTCTGTTTTCAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059450220 Original CRISPR TCACTTCTGTTTTCAGAATG TGG Intronic
No off target data available for this crispr