ID: 1059452102

View in Genome Browser
Species Human (GRCh38)
Location 9:114376968-114376990
Sequence CATCTATCTGTGGCATGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059452097_1059452102 18 Left 1059452097 9:114376927-114376949 CCTTGGGCTGAGGGCAGAAGAAT 0: 1
1: 0
2: 3
3: 46
4: 307
Right 1059452102 9:114376968-114376990 CATCTATCTGTGGCATGCTGCGG 0: 1
1: 0
2: 1
3: 10
4: 146
1059452094_1059452102 29 Left 1059452094 9:114376916-114376938 CCAGATGTGTTCCTTGGGCTGAG 0: 1
1: 0
2: 0
3: 19
4: 497
Right 1059452102 9:114376968-114376990 CATCTATCTGTGGCATGCTGCGG 0: 1
1: 0
2: 1
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059452102 Original CRISPR CATCTATCTGTGGCATGCTG CGG Exonic
900342819 1:2196891-2196913 CAGCTCTCTGTGCCGTGCTGGGG + Intronic
900861637 1:5237369-5237391 AATCTACCTGTGGCAAGTTGGGG + Intergenic
905170706 1:36108102-36108124 CATTTATCTGTGCAAAGCTGAGG - Intronic
906434399 1:45782540-45782562 CAGCTATATGGGGGATGCTGAGG + Intergenic
917670292 1:177267419-177267441 CATGTAACTTTGGCTTGCTGTGG + Intronic
917686631 1:177423242-177423264 CACCTCTCTGTGGCCAGCTGGGG + Intergenic
919633792 1:199984279-199984301 AATATATTTGTGGCATGTTGCGG - Intergenic
921268884 1:213449421-213449443 CCTCTCTCTGTGGCTTGCAGAGG + Intergenic
921621819 1:217333945-217333967 ATTCTATCTATGTCATGCTGTGG - Intergenic
922356875 1:224784732-224784754 AATCTATGTCTGGCATGATGTGG + Intergenic
923495127 1:234517938-234517960 CATTTATCTATTGAATGCTGTGG - Intergenic
924017703 1:239745122-239745144 CGTCTTTCTGTGACATGCTAAGG + Intronic
1063273348 10:4536808-4536830 CATCTGTCTGGGAGATGCTGTGG - Intergenic
1063873412 10:10445062-10445084 CATTAATCTGGAGCATGCTGTGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1072730138 10:97840737-97840759 CATCTCTCTGAGGCATACAGTGG + Intergenic
1073737785 10:106369502-106369524 CCTCCATCTGTTGCCTGCTGAGG + Intergenic
1075687362 10:124373650-124373672 CAGCTATCTCTGCCATGATGTGG + Intergenic
1076613381 10:131740418-131740440 CATGCATCTGTACCATGCTGTGG + Intergenic
1076678144 10:132158631-132158653 CATCTTCCTGTGAGATGCTGTGG + Intronic
1076678150 10:132158660-132158682 CATCTTCCTGTGTGATGCTGTGG + Intronic
1076678156 10:132158689-132158711 CATCTTCCTGTGTGATGCTGTGG + Intronic
1076678162 10:132158718-132158740 CATCTTCCTGTGTGATGCTGTGG + Intronic
1076678168 10:132158747-132158769 CATCTTCCTGTGTGATGCTGTGG + Intronic
1076678174 10:132158776-132158798 CATCTTCCTGTGTGATGCTGTGG + Intronic
1076678180 10:132158805-132158827 CATCTTCCTGTGTGATGCTGTGG + Intronic
1076678186 10:132158834-132158856 CATCTTCCTGTGTGATGCTGTGG + Intronic
1076678192 10:132158863-132158885 CATCTTCCTGTGTGATGCTGTGG + Intronic
1076678198 10:132158892-132158914 CATCTTCCTGTGTGATGCTGTGG + Intronic
1078064841 11:8071716-8071738 CAGCTCTCTCTGTCATGCTGTGG - Intronic
1080734036 11:34992403-34992425 CATCTATCTGTTTGATGCTATGG - Intronic
1080744773 11:35098983-35099005 CCTCTGTCTGGGGCAGGCTGGGG - Intergenic
1081298390 11:41420259-41420281 CCTCTATTTGTGGCATGGTGAGG - Intronic
1081390634 11:42524748-42524770 CGTCCAGCTGTGGCCTGCTGAGG - Intergenic
1081466751 11:43326352-43326374 GTTATATCTGGGGCATGCTGGGG + Intronic
1084110468 11:67010938-67010960 CATATTTGTGTGGCGTGCTGTGG - Exonic
1089879684 11:121761905-121761927 CATCTTTCAGTGGCCTGCTGTGG + Intergenic
1091046387 11:132329498-132329520 CATCTCTCTGGGGCAGCCTGCGG - Intronic
1093450784 12:19311079-19311101 CATTTCTCTGTAGCATGCAGTGG + Intronic
1095589494 12:43887934-43887956 CTTCTTTCTGTGCTATGCTGTGG + Intronic
1098693360 12:73518918-73518940 CAACTATTTGTGGCATCCAGGGG - Intergenic
1099957203 12:89362349-89362371 CAACTGTCTGTGTCATGGTGCGG + Intergenic
1103557471 12:121775192-121775214 GGTGTATGTGTGGCATGCTGGGG + Intronic
1105310432 13:19203822-19203844 TTACTGTCTGTGGCATGCTGTGG - Intergenic
1105360140 13:19705158-19705180 TTACTGTCTGTGGCATGCTGTGG - Intronic
1105877410 13:24570912-24570934 TTACTGTCTGTGGCATGCTGTGG + Intergenic
1108372697 13:49786769-49786791 CAACTATGTGTGGCATGCTAAGG + Intronic
1109972911 13:69793652-69793674 TATCTATGTGTGGTATGCAGAGG - Intronic
1115876996 14:37872093-37872115 AATGTATCTGGGGCATTCTGGGG + Intronic
1118458009 14:65962352-65962374 GCTGCATCTGTGGCATGCTGTGG + Intronic
1121047429 14:90798258-90798280 CATCCATCAGTGGCCTGCTATGG - Intronic
1121991521 14:98562261-98562283 CATCTCTCTTTGGGAGGCTGAGG - Intergenic
1122415133 14:101545826-101545848 CACGTAACTGTGGGATGCTGGGG - Intergenic
1124244086 15:28055593-28055615 AAGCTATGTGTGGAATGCTGTGG + Intronic
1126123294 15:45272543-45272565 CATGTATCTGTGGAATGCATGGG - Intronic
1126969174 15:54090479-54090501 GATCTATCTTTGGTAAGCTGGGG - Intronic
1127324544 15:57882520-57882542 CACATATCTGTGGCCTGCAGAGG + Intergenic
1127414328 15:58743098-58743120 CAGCTCTATGTGACATGCTGGGG - Intronic
1128135260 15:65258398-65258420 CATGGATCTGTGGCACACTGGGG + Exonic
1129663169 15:77564734-77564756 CCTCTATCTGTGCCATGAAGAGG - Intergenic
1134692569 16:16200604-16200626 CACCTAGCTCTGGCATGCTCAGG + Intronic
1141456744 16:84147250-84147272 CATTTATCTGTTGCTTCCTGTGG + Intronic
1146302325 17:31699034-31699056 CAACTATGTGTGGGAGGCTGAGG + Intergenic
1146491893 17:33289390-33289412 CATGTCCCTGTGGCATGCAGAGG - Intronic
1147761353 17:42799347-42799369 CACCTCTCTGTGGGGTGCTGGGG + Intronic
1149661310 17:58335394-58335416 CATCTCTGTGTGCCAAGCTGAGG + Intergenic
1149726597 17:58901081-58901103 CATCATGCTGTGGCATGATGTGG - Intronic
1151073241 17:71241498-71241520 AATCTAGCTGTGGCAGGCCGAGG + Intergenic
1152890704 17:82880262-82880284 CATCTGTCTGTGGGAGGCAGAGG - Intronic
1156912019 18:42422610-42422632 CATCTAACTTTGGGAGGCTGAGG + Intergenic
1157503435 18:48207742-48207764 AATATATCTGTGGCCTGGTGTGG - Intronic
1158207673 18:55011540-55011562 CCTCTATCTCTGGAATGCAGTGG - Intergenic
1159868954 18:73739243-73739265 CATCTATCTTGGGCAGGATGTGG - Intergenic
1161883334 19:6973143-6973165 CATCTCACTGTGGCAAGCTCTGG + Intergenic
1164187099 19:22880027-22880049 CATTTATCTGTGGCATCATTGGG - Intergenic
1164455055 19:28400056-28400078 CATCTATCTGCTCCAGGCTGTGG + Intergenic
1164767694 19:30784416-30784438 CCTCTATTAGTGGGATGCTGGGG - Intergenic
1166738134 19:45098093-45098115 CACCTGGCTGTGGCTTGCTGAGG - Intronic
925305877 2:2847670-2847692 TATGTATATGTGGCATGCTGTGG - Intergenic
925333373 2:3075583-3075605 CATCTCTCTGGGGCGTGCAGTGG - Intergenic
925538084 2:4937745-4937767 GAGCTAGCTGTGGAATGCTGAGG + Intergenic
926622872 2:15062987-15063009 CATCTAGCTATGGCTTGTTGGGG + Intergenic
934542239 2:95185352-95185374 CAACTGTCTGTGCCAGGCTGCGG - Intergenic
937080424 2:119136356-119136378 CATCAGTCTCTGGCCTGCTGGGG + Intergenic
937528022 2:122795146-122795168 CATCAATAAGAGGCATGCTGTGG - Intergenic
938734360 2:134172947-134172969 CATCTAGTTGTGGGATGCTGGGG - Intronic
939565941 2:143786612-143786634 CATCTATCTGTGTGATTCTTGGG - Intergenic
947739391 2:232478293-232478315 CTTCTCTCTGTGTCCTGCTGAGG - Intergenic
947856765 2:233329298-233329320 CACCCATCTGTGGGAAGCTGGGG - Intronic
947980110 2:234401493-234401515 CAAGTATCTGTAGCATGCTCTGG + Intergenic
1169925449 20:10779293-10779315 CATGTATGTGTGGCAGGGTGGGG - Intergenic
1172882142 20:38209016-38209038 CCTCTGCCTGGGGCATGCTGGGG - Intergenic
1172975235 20:38901172-38901194 GGTCTATCTGTGGGGTGCTGGGG - Intronic
1175433091 20:58920988-58921010 CATCTATATGGGGCTTGGTGAGG + Intergenic
1179555208 21:42170324-42170346 AATCTATCTGTGTCATTATGTGG + Intergenic
1181979990 22:26759543-26759565 CATCATTCTGGGACATGCTGGGG + Intergenic
1182791632 22:32957898-32957920 GCTCTATCTGAGTCATGCTGGGG - Intronic
952160012 3:30683999-30684021 CAAATATCTGAGGCATTCTGAGG + Intronic
954264320 3:49461135-49461157 CATCCATCTCTGGGATGCTCTGG - Intergenic
955656910 3:61253857-61253879 CTTCTATCTCTGGCTTTCTGTGG - Intergenic
956987033 3:74712525-74712547 GATGTATCTGTGGCATGGAGTGG - Intergenic
957977958 3:87471777-87471799 CACCTATCTGTAGCAGGCTTAGG - Intergenic
965360381 3:167732521-167732543 CATCTTTCAGTCACATGCTGCGG - Intronic
966641132 3:182191823-182191845 CTTCTATCTGTACCATTCTGTGG + Intergenic
967842002 3:194013207-194013229 CAGCTTCCTGTGGAATGCTGCGG - Intergenic
968283307 3:197493309-197493331 CATCTGTCTGTGGCAGGCAGGGG + Intergenic
969392641 4:6901614-6901636 CATATTTCTGGGGCAGGCTGGGG - Intergenic
969632056 4:8344499-8344521 CAAATATGTGTGGCATGCTCTGG - Intergenic
970894872 4:21090290-21090312 AATCTATCTGTGTCACACTGTGG - Intronic
977356848 4:95956401-95956423 CATCTATCTGTTGAATGCTGAGG - Intergenic
978722927 4:111934676-111934698 CATTTTTCTGTGGCATTTTGGGG + Intergenic
980180751 4:129397775-129397797 CACCTATCTGTGGCACCCAGTGG + Intergenic
981388753 4:144162658-144162680 AATCTGTCTGTGGAATACTGAGG + Intergenic
982642886 4:157984977-157984999 CATGTATCTGGGCCATGCTCTGG + Intergenic
986300463 5:6474647-6474669 ATTCTAACTGTGGCATGCGGGGG + Intronic
991475107 5:67010749-67010771 CAACTCTCTGTGGAGTGCTGGGG - Intronic
999366725 5:151028247-151028269 CATCCATTTGTGCCAGGCTGGGG - Exonic
999810259 5:155120851-155120873 CACCTATCCGAGGCATTCTGAGG - Intergenic
1001592217 5:172873387-172873409 CATCTGTCTGTTGCAGGTTGGGG + Intronic
1010151622 6:72739371-72739393 CAACTATCTGGGGTATGCTATGG + Intronic
1012583046 6:100892188-100892210 CATCTATCAGTTGCATGAAGTGG - Intergenic
1013978842 6:116106052-116106074 CAGCTACCTGGGGCATGCAGGGG + Intronic
1014690153 6:124553595-124553617 CCTCTATATGTGGCCTGGTGTGG - Intronic
1016324965 6:142890517-142890539 CATCTCTCTGTGTTGTGCTGGGG - Intronic
1017648145 6:156557539-156557561 CCTCTTTTTGTGGCATGATGAGG + Intergenic
1019958396 7:4435603-4435625 CATCTCTCTGAGGAATTCTGGGG + Intergenic
1019994677 7:4716586-4716608 CATGTCACTGTGGCCTGCTGTGG + Intronic
1029564531 7:101327126-101327148 CATGTACCTGTGGGAGGCTGAGG - Intergenic
1031871501 7:127093031-127093053 GAGGTGTCTGTGGCATGCTGAGG - Intronic
1032494159 7:132348501-132348523 GATCTTTCTGTGTCATGATGTGG - Intronic
1033171979 7:139092517-139092539 CATCTCTCTGTGACCTGCAGAGG - Intronic
1035037388 7:155904066-155904088 CATCCCTCTGTGGCATCCTGTGG - Intergenic
1035829293 8:2676908-2676930 CAAATACCTGTGGCCTGCTGTGG - Intergenic
1039841416 8:41295940-41295962 CAACTATTTGTGGGATGCGGAGG + Intronic
1040939164 8:52815314-52815336 CAGCTCTGTGTGGCATCCTGAGG - Intergenic
1042355503 8:67823424-67823446 CATCTAAATGTGGAATGTTGGGG + Intergenic
1044106747 8:88217643-88217665 CAACTGTCTGTGGCATGCAGAGG - Intronic
1044648055 8:94465754-94465776 CATCTATTTGATGCATGCTTGGG - Intronic
1049107065 8:140620737-140620759 CATGCATCTGTGGGAGGCTGAGG + Intronic
1049632831 8:143668132-143668154 CACCTCTCTGGGGCAGGCTGAGG - Intergenic
1049804565 8:144533051-144533073 CATGCATCTGTGGCATGCAGGGG - Intronic
1049944278 9:579506-579528 GATCTGTGTGTTGCATGCTGTGG - Intronic
1050172033 9:2830038-2830060 CATCAATCTGTGTCACTCTGAGG + Intronic
1051161029 9:14207489-14207511 CCTCAATTTGTGGCATGCTATGG - Intronic
1056453535 9:86739147-86739169 CAACTGTGTGTGCCATGCTGAGG - Intergenic
1056581201 9:87888995-87889017 CTTCTGTCTGTGCCATGCTAGGG + Intergenic
1058632344 9:107002186-107002208 CATCTAGCTGTGCCCTACTGTGG + Intronic
1058792434 9:108463831-108463853 CATCTATCTATGGGATTCTGGGG - Intergenic
1059452102 9:114376968-114376990 CATCTATCTGTGGCATGCTGCGG + Exonic
1059640438 9:116211657-116211679 CATCTTTCTATGGCATGCCTGGG + Exonic
1059665893 9:116446377-116446399 CATCTCTCTGAAGCAGGCTGAGG + Intronic
1203377786 Un_KI270442v1:390932-390954 CATTTATCGGTGTCAGGCTGGGG + Intergenic
1187028763 X:15463600-15463622 CATCTGCCTGTGACCTGCTGGGG - Intronic
1192509013 X:71711240-71711262 CATCTATCTGTGGGATTCCAGGG - Intergenic
1192517684 X:71770313-71770335 CATCTATCTGTGGGATTCCAGGG + Intergenic
1196692346 X:118573894-118573916 CATCTGTCCGTGAAATGCTGTGG + Exonic
1197555102 X:127943582-127943604 CATTTCTATGTGGCATCCTGAGG - Intergenic
1200812087 Y:7496567-7496589 AATCTCTCTGTGTTATGCTGTGG - Intergenic