ID: 1059454542

View in Genome Browser
Species Human (GRCh38)
Location 9:114391342-114391364
Sequence CCAATTTTATAGTGAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059454538_1059454542 8 Left 1059454538 9:114391311-114391333 CCAACTAATTGCAATTCACAAAG 0: 1
1: 0
2: 1
3: 6
4: 151
Right 1059454542 9:114391342-114391364 CCAATTTTATAGTGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059454542 Original CRISPR CCAATTTTATAGTGAGGCCC TGG Intronic
No off target data available for this crispr