ID: 1059456539

View in Genome Browser
Species Human (GRCh38)
Location 9:114403418-114403440
Sequence TGAGCTCTGCTGACCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059456539_1059456546 6 Left 1059456539 9:114403418-114403440 CCACCCTGGGTCAGCAGAGCTCA 0: 1
1: 0
2: 3
3: 24
4: 256
Right 1059456546 9:114403447-114403469 AGCCCTGTGTCGGGAGCCTCAGG 0: 1
1: 0
2: 3
3: 15
4: 161
1059456539_1059456544 -3 Left 1059456539 9:114403418-114403440 CCACCCTGGGTCAGCAGAGCTCA 0: 1
1: 0
2: 3
3: 24
4: 256
Right 1059456544 9:114403438-114403460 TCAGGCTCCAGCCCTGTGTCGGG 0: 1
1: 1
2: 2
3: 32
4: 356
1059456539_1059456543 -4 Left 1059456539 9:114403418-114403440 CCACCCTGGGTCAGCAGAGCTCA 0: 1
1: 0
2: 3
3: 24
4: 256
Right 1059456543 9:114403437-114403459 CTCAGGCTCCAGCCCTGTGTCGG 0: 1
1: 0
2: 2
3: 33
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059456539 Original CRISPR TGAGCTCTGCTGACCCAGGG TGG (reversed) Intronic
901000311 1:6145814-6145836 TGAGCACTGCCTACCCTGGGAGG - Intronic
902123009 1:14183893-14183915 TGTGCTCTGCTGACCTAAGGAGG + Intergenic
902220317 1:14960482-14960504 TGAGCTCTGCAGACTGTGGGTGG + Intronic
902923974 1:19683468-19683490 TGGGCTCTGCACACCCACGGTGG - Intronic
903788378 1:25875874-25875896 TGGGCCCGGCTGACCCTGGGAGG + Intergenic
906671973 1:47662664-47662686 TGAGCTTTACTGACTAAGGGAGG - Intergenic
907316175 1:53574180-53574202 AGAGCTGTGCTGGACCAGGGAGG - Intronic
912329794 1:108808392-108808414 TAAACTCTCCTGACCCATGGAGG + Intronic
914323511 1:146588245-146588267 TGAGCTCAGCAGAACCAGGTTGG + Intergenic
916214183 1:162381999-162382021 TGGGCTCTGGTGAGCCTGGGGGG + Exonic
919784979 1:201253203-201253225 TGCGCTCTGCTGCCCAGGGGAGG + Intergenic
920527402 1:206677402-206677424 GGAGCCCTCCTGACCCAGGGAGG - Intronic
921674811 1:217965578-217965600 TGTGCTCTGCAGAGCCAGAGGGG - Intergenic
922345773 1:224695190-224695212 TGAGCTCTCCTGAGCAAGAGTGG + Intronic
924708465 1:246516588-246516610 AGGGCTCTCCTGGCCCAGGGAGG - Intergenic
1063140992 10:3256553-3256575 TGTGCTCTGTTCACCCAGGCTGG - Intergenic
1065237148 10:23664568-23664590 GGAGCCTCGCTGACCCAGGGGGG - Intergenic
1065665331 10:28053617-28053639 TGAGCTCTGCTGTTTCTGGGTGG - Exonic
1066623307 10:37380807-37380829 TGAGCCCTGCTGCCCCTGGCTGG - Intronic
1067571029 10:47371066-47371088 TGAGCTCTGAGGACCCAGAAGGG + Intronic
1074434823 10:113425085-113425107 TGTGCTCTCCTGACACAGCGGGG + Intergenic
1074531094 10:114299410-114299432 TGATCTCTACAGACCCAGAGAGG + Exonic
1075303728 10:121348877-121348899 TAAGCTCTGTAGACACAGGGTGG + Intergenic
1075318925 10:121474102-121474124 TTAGCTCTTCTCACCCAGGCTGG + Intergenic
1075613215 10:123870338-123870360 TGAGCTCTGCTCTGCCAGCGGGG - Intronic
1075739280 10:124684029-124684051 TTAGCTCTGCTGACCTTGGCAGG - Intronic
1076235924 10:128863847-128863869 TGAGCTCTTCTTACCAAGGGTGG + Intergenic
1076731943 10:132443736-132443758 TGAGCTCAGCTGAGGGAGGGCGG + Intergenic
1077278628 11:1730700-1730722 TGTGCTCAGCTGTCCCACGGGGG - Intergenic
1077474543 11:2780174-2780196 AGAGCTGTGCTGACCTAGGTGGG + Intronic
1083589993 11:63888278-63888300 TCAGATGTGCTGACCCAGAGTGG - Intronic
1084028922 11:66469493-66469515 TGAGCTCTTCTCACACATGGGGG - Intronic
1084913774 11:72412127-72412149 TGAAGTCTGCTGTCCCAGGCTGG - Intronic
1089023525 11:115243212-115243234 TGCGCTCTGCAAACCCATGGTGG + Intronic
1089209688 11:116791727-116791749 TGGGCTCTCCTCCCCCAGGGTGG + Intronic
1090470738 11:126978740-126978762 TGAGCTCTGTTCCCCCAAGGTGG + Intronic
1091663717 12:2403393-2403415 GGAGCTGTGAGGACCCAGGGAGG + Intronic
1093751365 12:22804038-22804060 TCAGCTCTGCTGTCCGAGGATGG + Intergenic
1095040063 12:37431723-37431745 TTAGCTCTGGTCACCCAGGCTGG + Intergenic
1096041140 12:48518586-48518608 GGAGCTCTGCTGAACCTTGGAGG - Intronic
1096576929 12:52558675-52558697 TGAGGGCTACTGAGCCAGGGAGG + Intergenic
1096840475 12:54376713-54376735 AGACGTCTGCTGACCCAGGGTGG - Intronic
1102603104 12:114047811-114047833 AGAGCTCTGCTGACCCTAGCTGG - Intergenic
1102963925 12:117111909-117111931 TGAGCTCTGCTGAGTCAGCGTGG - Intergenic
1103013081 12:117472873-117472895 GGGGCTCTGCTGACCCTGGAGGG + Intronic
1103923877 12:124413202-124413224 TGGGCGCTGTTGACCCTGGGAGG + Intronic
1105832085 13:24171594-24171616 TCAGCACAGCTGACCCAGTGGGG - Intronic
1106854996 13:33841871-33841893 TGAGTTCTGGTGACCCAGAATGG - Intronic
1106925376 13:34607740-34607762 TGAGACCTTCTGAACCAGGGGGG + Intergenic
1107217108 13:37934621-37934643 TTAGCTCTGCTGACCGCGGATGG + Intergenic
1109396888 13:61770963-61770985 TGAGCTCAGCTCAGCCAGGTGGG - Intergenic
1113127889 13:107000351-107000373 TGAGCAATGCTGACACAGGAAGG - Intergenic
1113457519 13:110458910-110458932 TGAGCCCTGGGAACCCAGGGAGG - Exonic
1114527894 14:23377849-23377871 TTAGCTCTGATGACCTAGGGTGG - Intronic
1116658267 14:47676216-47676238 TGAGCTCGGCTGACACAGGAAGG - Intergenic
1117763957 14:59060837-59060859 AGAGCTCTGCTGACCTATGAAGG - Intergenic
1118883394 14:69847731-69847753 TGACCACTGCAGCCCCAGGGAGG - Intergenic
1119195687 14:72715308-72715330 GCAGCTCTGCAGCCCCAGGGCGG + Intronic
1120997502 14:90427781-90427803 TTGGCTCTGCTGAGCCAAGGTGG + Intergenic
1122131100 14:99604781-99604803 TGAACTCTGGTGCCCCCGGGAGG - Intergenic
1122268214 14:100556586-100556608 AGAGGGCTCCTGACCCAGGGGGG - Intronic
1122624002 14:103075086-103075108 TGAACTCTGCCAGCCCAGGGCGG + Intergenic
1122866854 14:104609919-104609941 TGAGTTCTGCTGAGAGAGGGAGG - Intergenic
1122895731 14:104755914-104755936 AGAGTCCTGCTTACCCAGGGAGG - Intronic
1123109441 14:105858870-105858892 TGAGCTGGGCTGAGCCAGGCTGG - Intergenic
1123851445 15:24361557-24361579 TGAGCTCTGCCAAGCCAGAGAGG - Intergenic
1123873635 15:24601097-24601119 TAAGCTCTGCTGTCCACGGGTGG - Intergenic
1124632861 15:31347269-31347291 TGAGGTGTGCTGTCCCAGTGGGG - Intronic
1124708904 15:31988639-31988661 TGTGCACTGCTGGGCCAGGGAGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127077317 15:55339842-55339864 TGGACTCTGGTGACTCAGGGTGG + Intronic
1127234801 15:57037409-57037431 TGAGCTCTTGTCACCCAGGCTGG - Intronic
1128770110 15:70275716-70275738 TGAGGTCTGGTGAGCCATGGAGG - Intergenic
1129925823 15:79363793-79363815 TGAGCTTTGCTGCACCAGGTGGG - Intronic
1132313910 15:100877417-100877439 TGAGCACCTATGACCCAGGGTGG - Intergenic
1133239973 16:4408434-4408456 AGGGCCCTGCTGACCCAGGGTGG + Intronic
1137253959 16:46760114-46760136 TGATCTCTGCTCATCCAAGGGGG + Intronic
1137612572 16:49828807-49828829 AGAGGTCTGGAGACCCAGGGAGG + Intronic
1138583462 16:57956296-57956318 TCTGCTCTGCTGCCCCAGGTTGG + Intronic
1139581770 16:67878075-67878097 TGAGCTGGGCTGACTCACGGTGG - Intronic
1140010050 16:71122604-71122626 TGAGCTCAGCAGAACCAGGTTGG - Intronic
1142154846 16:88528247-88528269 TGGGCTCTCCGCACCCAGGGCGG + Intronic
1142489129 17:266556-266578 GGAGCTTTGCTGCCCCAGGGGGG - Intronic
1142781694 17:2186190-2186212 TGATCTCAGCTCACCCAGGCTGG - Intronic
1144640672 17:16934920-16934942 TGGGCCCTGCTGACCCAGGCGGG - Intronic
1144803568 17:17948879-17948901 TGATCTGTGCTGACCCTGTGAGG + Intronic
1145304873 17:21668311-21668333 TGTGCTCTGCTGACTAAGGCAGG + Intergenic
1146268661 17:31470193-31470215 TGGACTCTGCTACCCCAGGGAGG - Intronic
1146534791 17:33640802-33640824 TGAGCCCTGCTGCCCCTGGCTGG + Intronic
1146913042 17:36660285-36660307 TGTGCCCTCCTGACCCAGGTGGG - Intergenic
1147444267 17:40465227-40465249 TGAGCTCTCCTGTCCCAGGAAGG - Intergenic
1147856394 17:43483729-43483751 CGCCCTCTGCCGACCCAGGGCGG + Intergenic
1148025965 17:44587811-44587833 TGTCCTCTGCTGACCCACGGTGG + Intergenic
1150418349 17:65005991-65006013 TAAGCACTGCTGACCTTGGGGGG - Intergenic
1151052556 17:70995257-70995279 GGAGCCTTGCAGACCCAGGGAGG + Intergenic
1151292035 17:73157247-73157269 GGAGCTCTCCTCCCCCAGGGAGG - Intergenic
1151453094 17:74211357-74211379 GGAGGCCTGCTGACCCAGAGAGG - Intergenic
1151586286 17:75010704-75010726 GGAGGTCTTCTGACCCAGGGCGG + Intergenic
1152159466 17:78658380-78658402 TGAGCTGTGCTGAACAAGTGGGG - Intergenic
1152333014 17:79684602-79684624 TGCGCTGTGCTGACCCGGGCTGG + Intergenic
1152605562 17:81287929-81287951 ACAGCTCTGCAGACCCAGGAAGG + Intronic
1152926497 17:83090106-83090128 TGGGCTCCCCTGCCCCAGGGTGG + Intronic
1153468496 18:5416196-5416218 TGGACTCTGATGGCCCAGGGAGG - Exonic
1157379959 18:47205093-47205115 TGACCTCTGCTGTCCCCTGGTGG + Intergenic
1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG + Intergenic
1158593256 18:58795070-58795092 TCATCTCTGAAGACCCAGGGAGG - Intergenic
1158825281 18:61211657-61211679 TGAGCTCTGCAGACTCAGTGTGG + Intergenic
1160237153 18:77094771-77094793 AGAGCTCTGTTGTCCCAGGGGGG + Intronic
1160506920 18:79432477-79432499 TGAGCAGTGCTGGTCCAGGGAGG + Intronic
1160831269 19:1105876-1105898 TGAGCCATTCTGCCCCAGGGAGG - Intronic
1161292585 19:3503124-3503146 GGAGCTGTGCTGACTCAGGAAGG + Intergenic
1161311938 19:3599786-3599808 GGACCTCTGGTCACCCAGGGTGG - Intronic
1161611799 19:5247424-5247446 AGAGCACTGCTGGCCCACGGGGG + Intronic
1162117805 19:8442134-8442156 TGAGCTCTCCTGCCCCTTGGGGG + Intronic
1163233112 19:16016953-16016975 TGGGCCCTGCTGAGCCAGGTAGG + Intergenic
1163237741 19:16039164-16039186 TGGGCCCTGCTGACCCATGCAGG - Intergenic
1163297952 19:16424512-16424534 AGAGCTCTGCAGACACAGGCTGG + Intronic
1163720078 19:18894659-18894681 AGACCACTGCGGACCCAGGGAGG + Intronic
1163831391 19:19548674-19548696 TGCCCTGAGCTGACCCAGGGTGG - Intergenic
1164131796 19:22369583-22369605 TTTGCTCTGCTCACCCAGGCTGG - Intergenic
1166137646 19:40786961-40786983 TGAGCTCTGTGGAGCCAGGTGGG + Exonic
1167039287 19:47013137-47013159 GGCGCTCTGCTGACCCCTGGTGG - Intergenic
1167505931 19:49871103-49871125 TGGGCTCTGCTGGCCTAGGTGGG - Intronic
925206767 2:2013743-2013765 AGAGCCCTGCTGGCCCAGGTGGG + Intronic
925966543 2:9072026-9072048 TGAGCTCTCCTTTCCCTGGGAGG - Intergenic
926666840 2:15534341-15534363 TGAGCTCTTCTGAGCCAGATGGG - Intronic
927834239 2:26379228-26379250 TGCGCTCTTCTCACCCAGGCTGG - Intronic
930685357 2:54301963-54301985 TGAGCTCTGTTTACCCTGTGGGG - Intronic
932703099 2:74004032-74004054 TATCCTCTGCTGGCCCAGGGCGG + Intronic
934762631 2:96864913-96864935 GGAGCCCTGCTGGCCCAGCGGGG - Intronic
935218211 2:100990940-100990962 TGAGTGCTGCTGGCCCAGGCGGG - Intronic
935268204 2:101412255-101412277 GGAGCTCTCCAGACTCAGGGAGG - Intronic
935387271 2:102513226-102513248 TGAGCTTTGCTGTCCCAGCTCGG - Intronic
936058615 2:109279994-109280016 TAGGCTGTGCTGCCCCAGGGTGG + Intronic
942425217 2:175853051-175853073 TGGGCCCAGCTGACTCAGGGAGG - Intergenic
944488455 2:200232354-200232376 AGAGCTCCGCTGCCCCAGGAGGG - Intergenic
946902275 2:224384111-224384133 TGAGCTGGGCTGGCCCAGGAGGG - Intronic
948948156 2:241232101-241232123 TCAGCTCTGCTGGGCCACGGTGG - Intronic
1170210424 20:13841610-13841632 TGAGCTCTGGTGACTCACAGTGG + Intergenic
1170674676 20:18467723-18467745 TGAGTTCTGCTCTCCCAGGATGG - Intronic
1170733552 20:18994187-18994209 TAAGCTTTGATCACCCAGGGGGG + Intergenic
1171271551 20:23822214-23822236 AGAGCTGTGTTGACCAAGGGTGG - Intergenic
1171340201 20:24421355-24421377 TGGGCTCTGCTGCCCAAGGTGGG + Intergenic
1171482496 20:25464627-25464649 TGAGAGCTGCTGTCCCCGGGAGG - Intronic
1171522382 20:25785751-25785773 TGTGCTCTGCTGACTAAGGCAGG + Intronic
1171554445 20:26070132-26070154 TGTGCTCTGCTGACTAAGGCAGG - Intergenic
1171961372 20:31497210-31497232 TGCGCACAGCTGACTCAGGGAGG + Intergenic
1174149506 20:48476208-48476230 TGGGATCTGGTGACCCGGGGAGG - Intergenic
1176041964 20:63070427-63070449 CAAACTCTGCTGACCCAAGGAGG + Intergenic
1176656187 21:9590749-9590771 TGTGCTCTGCTGACTAAGGCAGG + Intergenic
1177295046 21:19162895-19162917 TGAGCTCTGCTGCCAGGGGGTGG + Intergenic
1178660546 21:34504065-34504087 TGAGCTCAGCTGACAGAGGCAGG - Intergenic
1178980266 21:37257856-37257878 TGGGCTCTGCTGCCTCCGGGTGG + Intronic
1179080753 21:38168698-38168720 TGTGCTGTGCTTACCCAGTGGGG + Intronic
1179926794 21:44539239-44539261 TGAGCCCAGCTGGCCCAGGGCGG + Exonic
1179928323 21:44550601-44550623 TGAGCTGTGCTGAGGCTGGGTGG + Exonic
1179939357 21:44628118-44628140 TGAGCTGTGCTGAGGCTGGGTGG - Exonic
1180915098 22:19480219-19480241 TGAGTTCTGCGGACCCTAGGAGG + Intronic
1182356071 22:29722723-29722745 TGAGTGCTCCTGCCCCAGGGCGG + Intronic
1184467401 22:44676954-44676976 TGAGTTCTGCTGAGTCATGGGGG + Intronic
1185013796 22:48331925-48331947 TGAGCTCAGCTCACCTGGGGAGG + Intergenic
1185192608 22:49448075-49448097 ACAGCCCTGCTGAGCCAGGGAGG - Intronic
1185310500 22:50151660-50151682 AGAGCTCTGCTGTCCCCCGGAGG + Intronic
949392133 3:3573971-3573993 TCAGTTTTGCTGTCCCAGGGTGG - Intergenic
950124769 3:10504582-10504604 TGTCCTCTGCTCACCCAGGTTGG - Intronic
951428914 3:22583476-22583498 TGAACTCTGATGACACAAGGAGG + Intergenic
952115944 3:30181784-30181806 GGCCCTCTGCTGACCCAGGCTGG + Intergenic
952883366 3:37998818-37998840 GGAGCTCGGCTGTCCCAGAGCGG + Intronic
953520330 3:43636281-43636303 TGAGGACTGCTGGCCAAGGGAGG + Intronic
954868582 3:53750041-53750063 TGAGAACTGCTGACCGAGGGGGG + Intronic
955517898 3:59746370-59746392 TGAGCTCTGCTGACACAACAGGG + Intergenic
961330026 3:126132935-126132957 TGGGCTCTCCTTGCCCAGGGTGG - Intronic
963004299 3:140711598-140711620 AGAGATCTTCTGGCCCAGGGAGG + Intergenic
963762081 3:149294418-149294440 TCACCTCTGTTGACCCAGGAGGG + Intergenic
964144377 3:153441607-153441629 TTTGCTCTGCTGCCCCAGGCTGG + Intergenic
964328080 3:155569589-155569611 GGAACTCTACTGACCCAGGCAGG + Intronic
967091019 3:186134854-186134876 CAAGCCCTGCTGACCCAGGAGGG - Intronic
967190577 3:186981191-186981213 AGAGCTCTGCTGCCGCAGTGAGG + Intronic
969428138 4:7137860-7137882 TGGGCTCTGCTGGAACAGGGAGG + Intergenic
972451681 4:39206475-39206497 TGAGCACTTGTGACCAAGGGAGG - Intronic
973369715 4:49235535-49235557 TGAGCCCTGTTGACCCAAGCAGG - Intergenic
973391316 4:49559881-49559903 TGAGCCCTGTTGACCCAAGCAGG + Intergenic
975747897 4:77492610-77492632 TGAGGTCAGGTGACTCAGGGAGG + Intergenic
976586383 4:86801779-86801801 TGGGCTCTGCTGACCCATGGAGG - Intronic
982230536 4:153204725-153204747 TGAGCTCTGTTAATCCAGGCAGG + Intronic
982390808 4:154862245-154862267 TGAGGTCTGAGGAGCCAGGGAGG - Intergenic
983469260 4:168136637-168136659 TGAGCTCTGCAGAGCCATGGGGG - Intronic
983815606 4:172122690-172122712 TGGGCTCTTCTGACCCAGAAGGG - Intronic
985943173 5:3155273-3155295 TGAGCCCTGCTCCCCCTGGGTGG + Intergenic
987064740 5:14278370-14278392 TGAGCTACGGTGACCCAGGAGGG + Intronic
987301776 5:16603866-16603888 TGTGCTCTTTTGACCCAGGGTGG - Intronic
987874460 5:23662338-23662360 TGGGCTATGCAGACCCAGGAAGG - Intergenic
989137359 5:38168253-38168275 CCAGTTCTGCTGGCCCAGGGTGG + Intergenic
992024537 5:72657513-72657535 TGAGCCCTGCTCACCCATAGTGG - Intergenic
996477436 5:123937403-123937425 TGTGCTCTCCAGACCAAGGGTGG + Intergenic
996653579 5:125913117-125913139 AGTTCTCTGCTCACCCAGGGTGG + Intergenic
999475868 5:151898527-151898549 TCCCCTCTGCTGACCCAGAGTGG - Intronic
999573561 5:152947786-152947808 GGAGCTCTGCTGAAGCATGGGGG + Intergenic
999707925 5:154291024-154291046 TCATCTCTGCAGACCCTGGGAGG + Intronic
1000852512 5:166357586-166357608 TGAGGACTGCTGCCCCAGGATGG + Intergenic
1001944370 5:175766647-175766669 TGAGCTCTGTAGATCCATGGGGG - Intergenic
1001997493 5:176173907-176173929 GGAGGTCTGATGACACAGGGTGG + Intergenic
1002043125 5:176528634-176528656 TGAGACCTTCTGACCCAGGATGG + Exonic
1002276447 5:178107184-178107206 CCAGCTCTGCTGACTCGGGGAGG + Intergenic
1002293119 5:178213058-178213080 TGAGCACTGATGGCCCTGGGAGG - Exonic
1002836372 6:868591-868613 TCTGCTCTGCTGTCCCCGGGTGG - Intergenic
1003552887 6:7114559-7114581 TCAGCTCTGCTGACGTATGGGGG - Intronic
1004916289 6:20335094-20335116 TGAGCTCTGTAGACCAAGGAGGG - Intergenic
1005575707 6:27187457-27187479 TGAGCTCTGCTGACCCAACAGGG + Intergenic
1005811235 6:29518020-29518042 TGGGCCCTGCTGACCCAGGCAGG + Intergenic
1007246283 6:40465628-40465650 TGGGCTCTCCTGACCCATGTAGG + Intronic
1007761114 6:44134338-44134360 TGAGTTCCCCAGACCCAGGGTGG + Intronic
1012800400 6:103820025-103820047 TGAGCTCTGCTGCCTCAGGTTGG - Intergenic
1013367334 6:109446100-109446122 ACAGATGTGCTGACCCAGGGTGG - Intronic
1015783832 6:136900464-136900486 TGAGATCTGCTGTCACTGGGGGG - Intronic
1016429151 6:143964662-143964684 TACGCTCTGGTGACCTAGGGTGG + Intronic
1017926697 6:158916953-158916975 TGCTCTCTGCAGACCCAGGAAGG + Intergenic
1017989109 6:159470901-159470923 TGAGCCCTGCAGAGCCACGGCGG - Intergenic
1018344750 6:162888688-162888710 TGACCCCTGCAGACCCAGGCAGG - Intronic
1018555778 6:165049468-165049490 TGTGCTCTCCAGACCAAGGGCGG - Intergenic
1019354274 7:570731-570753 AGAGCTCTGCTGACCGGGGTTGG - Intronic
1019437031 7:1027833-1027855 CGAGCTCTGAGGACCCTGGGTGG - Intronic
1019538541 7:1541138-1541160 TGTGCTCTGGTGACCCGAGGAGG + Exonic
1019654429 7:2182591-2182613 TGAGCTCTGATGACACAATGGGG + Intronic
1019793067 7:3029912-3029934 TGAGATCTGTGGACACAGGGAGG + Intronic
1020101171 7:5395033-5395055 TGAGCTCTGCAGGCCCAGAGAGG + Intronic
1021254345 7:18372081-18372103 TGAGCTCAGCTAACCCAGTAAGG + Intronic
1022444653 7:30460309-30460331 AGAGATCTGCTGGCCCTGGGGGG + Intronic
1022569820 7:31441373-31441395 TGAGCTCTGGTGTCCCTGAGGGG - Intergenic
1023022489 7:36022506-36022528 TGCGGTCTGCTGGCCCTGGGAGG + Intergenic
1023969568 7:44981010-44981032 AGAGGTCTGTTGACCCAGGAGGG - Intergenic
1024621456 7:51161212-51161234 GGAGCTGTGCTGCCACAGGGTGG - Intronic
1025301846 7:57824490-57824512 TGTGCTCTGCTGACTAAGGCAGG - Intergenic
1025730168 7:64101402-64101424 TCAGCTCTGCTGAGGCAGGAAGG + Intronic
1027876268 7:83773594-83773616 TGAGTTCTCCGGACACAGGGAGG + Intergenic
1029360053 7:100081836-100081858 TGTGGTTTGCTGACTCAGGGCGG + Intronic
1030352713 7:108507554-108507576 TGAGCTGGGCTGAACCTGGGAGG + Intronic
1032209620 7:129901623-129901645 TGAGATCTTCTTACCCAGGCTGG + Intronic
1032401758 7:131629075-131629097 TGAGCTCTGGTGACATAAGGTGG + Intergenic
1033134741 7:138775050-138775072 TGAGCTTTGCTTCTCCAGGGTGG + Intronic
1033348458 7:140543003-140543025 TGAGTTCTGGAGACCGAGGGAGG - Intronic
1034895560 7:154874354-154874376 TGAGCTCTGCTGAGCTCGGACGG + Intronic
1035284296 7:157796399-157796421 TCAGCTCTGCTGCCCCTGCGGGG + Intronic
1035750307 8:1991619-1991641 TGAGCTCTTCTGACCTGGTGTGG - Intronic
1038000140 8:23384391-23384413 TGAGCGTTGCTGACACAGAGGGG + Intronic
1038452586 8:27649486-27649508 GGAGCTCTCCTCACCCAGAGGGG + Intronic
1039584097 8:38691131-38691153 TCAGCACTACTGAGCCAGGGAGG - Intergenic
1039930439 8:41982587-41982609 TGAGATCTGCTGTCCCAGCTGGG + Intronic
1040593843 8:48819356-48819378 TGTGCTCTGCTCACTCGGGGAGG + Intergenic
1041737336 8:61125278-61125300 TGAGCACTGCTGCGCCATGGAGG - Intronic
1041768395 8:61445020-61445042 TGAGGTCTTCTGGACCAGGGAGG - Intronic
1042887064 8:73564039-73564061 TAAGCTATGCTGACTTAGGGGGG - Intronic
1043022846 8:75026112-75026134 TGAGCTGTGATGGCCCAGGCTGG + Intronic
1043087217 8:75849656-75849678 TGAGCTCTGATGAGCATGGGAGG - Intergenic
1043823796 8:84900895-84900917 TCAGCTCTGCTGAAACAGGCAGG + Intronic
1045790514 8:105978268-105978290 TGGCCCCTGCTGACCCAGGATGG + Intergenic
1048856069 8:138687587-138687609 TGTGATCTGCTCACGCAGGGAGG + Intronic
1049108589 8:140628855-140628877 TGAGCTCAGGTGATCCACGGTGG - Intronic
1049284054 8:141765050-141765072 TGGGCTCTGCAAACCCAGAGTGG + Intergenic
1049528049 8:143139028-143139050 TGAGCTGGGCTCAGCCAGGGTGG - Intergenic
1049694625 8:143977258-143977280 TGGGCTCTGCTGACCCCTGGTGG + Exonic
1052087309 9:24283682-24283704 TAAGCTTTGCTGACCAAGGCAGG - Intergenic
1052493355 9:29194193-29194215 TGAGCACTACTGATTCAGGGTGG + Intergenic
1053912630 9:42921895-42921917 TGGGCCCTGCTGACCCATGCAGG + Intergenic
1056874987 9:90319475-90319497 TGAGCTGTCCTAACCCAAGGTGG + Intergenic
1057704942 9:97389513-97389535 TGTGCTGTGCTGAGCCAGGAGGG - Intergenic
1059412142 9:114139278-114139300 AGAGCACTGCTGACCCAGGGAGG - Intergenic
1059456539 9:114403418-114403440 TGAGCTCTGCTGACCCAGGGTGG - Intronic
1059677714 9:116555544-116555566 TGAGCTCTGATGGCCTGGGGTGG - Intronic
1060027202 9:120183345-120183367 TGAGCTCTGGTGGCCCACAGTGG - Intergenic
1061710390 9:132483414-132483436 TGAGCTCCTCTGACCCACGAGGG + Intronic
1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG + Intronic
1062354404 9:136154815-136154837 TGGGCCCTTCTGACCCTGGGGGG - Intergenic
1062447508 9:136601865-136601887 TGAGCTCTACTGGCACTGGGTGG + Intergenic
1062468018 9:136690023-136690045 TGAGTGCTTCTCACCCAGGGAGG + Intergenic
1062473362 9:136715894-136715916 AGAGCTCTGCGGACAGAGGGAGG - Intronic
1203633903 Un_KI270750v1:94209-94231 TGTGCTCTGCTGACTAAGGCAGG + Intergenic
1185487945 X:497505-497527 TGGGCTCGGCGGACACAGGGTGG + Intergenic
1188202588 X:27309390-27309412 TGCCCTATGCTGACCAAGGGAGG + Intergenic
1190387243 X:49894260-49894282 GGAGCTCTGGGGACCCCGGGGGG + Intergenic
1193903633 X:87216217-87216239 TGCCCTCTGCTTACACAGGGAGG - Intergenic
1199800720 X:151248296-151248318 TGAGCTCAGCAGACCCAGCCTGG + Intergenic
1200083447 X:153591125-153591147 TGAGCTCTGCAGCACCCGGGTGG + Intronic
1201907136 Y:19097114-19097136 TGAGCTCTGTTGACCAGGGTTGG - Intergenic