ID: 1059460372

View in Genome Browser
Species Human (GRCh38)
Location 9:114425838-114425860
Sequence GAGATGCTTTGGGGTGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059460372_1059460383 22 Left 1059460372 9:114425838-114425860 CCAAATACACCCCAAAGCATCTC 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1059460383 9:114425883-114425905 TCTTTCATCTGCACAGATCTGGG 0: 1
1: 0
2: 0
3: 16
4: 246
1059460372_1059460384 28 Left 1059460372 9:114425838-114425860 CCAAATACACCCCAAAGCATCTC 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1059460384 9:114425889-114425911 ATCTGCACAGATCTGGGATGAGG 0: 1
1: 0
2: 5
3: 42
4: 355
1059460372_1059460385 29 Left 1059460372 9:114425838-114425860 CCAAATACACCCCAAAGCATCTC 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1059460385 9:114425890-114425912 TCTGCACAGATCTGGGATGAGGG 0: 1
1: 0
2: 1
3: 29
4: 245
1059460372_1059460382 21 Left 1059460372 9:114425838-114425860 CCAAATACACCCCAAAGCATCTC 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1059460382 9:114425882-114425904 CTCTTTCATCTGCACAGATCTGG 0: 1
1: 0
2: 0
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059460372 Original CRISPR GAGATGCTTTGGGGTGTATT TGG (reversed) Intronic
905187256 1:36205362-36205384 CAAATGGTTTGGGGTGCATTAGG + Intergenic
907507137 1:54927809-54927831 GAGAAGATTTGGGGTTTATCAGG + Intergenic
909719740 1:78754245-78754267 GAGATGATTTAGGGTATATGGGG + Intergenic
913099353 1:115548975-115548997 GAGATGCTTGGTGAAGTATTTGG - Intergenic
915898545 1:159829777-159829799 GAGCTGCTATAGGGTGAATTGGG - Intronic
916929902 1:169565832-169565854 GCTATCCTTTGGGGTGTGTTGGG - Intronic
918951377 1:191144300-191144322 GAGATGTTTTGGGTTTTACTAGG + Intergenic
919638659 1:200028914-200028936 GATATACTTTAGGGTGTAGTTGG - Intronic
922150885 1:223003287-223003309 CCGATGCTTTGGGGTTTATGCGG + Exonic
922489437 1:226003997-226004019 GTGTTCCTTTGGGGTGTTTTTGG - Intergenic
922887100 1:229028510-229028532 GAGATGCTGAGGGCTGTGTTTGG + Intergenic
923068662 1:230543105-230543127 GAGAGGCTTTGTGGTGTTTATGG + Intergenic
924212359 1:241784010-241784032 GAGAGGCTTTGAAGTATATTAGG + Intronic
1063611677 10:7568129-7568151 GAGATGTTTGGGGCTGAATTAGG + Intronic
1064212805 10:13374817-13374839 GAGACTATTTGGAGTGTATTGGG - Intergenic
1067574961 10:47403344-47403366 GAGTTTCTTTGGGGTGTGTTGGG + Intergenic
1067782430 10:49218583-49218605 GGGAAACTATGGGGTGTATTGGG + Intergenic
1067782626 10:49219907-49219929 GGGAAACTATGGGGTGTATTGGG + Intergenic
1068041145 10:51825784-51825806 GAGATGGTTTGGGGTGTGGAGGG + Intronic
1070820881 10:79353522-79353544 GGCATCCTCTGGGGTGTATTTGG + Intronic
1071818355 10:89254796-89254818 GAGATGCTTTAGGGTATCTGGGG - Intronic
1072536021 10:96363883-96363905 AAGAGGCTTTGGGGTATGTTTGG - Intergenic
1073541363 10:104318352-104318374 GAGATAATTTGGGGGGTTTTAGG + Intronic
1073560878 10:104495889-104495911 GAAATGTTTTGGGGTGTTTGTGG + Intergenic
1078011760 11:7577688-7577710 GAGACGCTTTGGGGTGTTTTGGG + Intronic
1080041185 11:27761125-27761147 GAGAAGGTGTGGGCTGTATTTGG + Intergenic
1082287539 11:50333766-50333788 GAGATCTCTTGGGGTGTCTTGGG + Intergenic
1082302550 11:50526965-50526987 GGGATGTTTTGGAGTGCATTGGG + Intergenic
1086680589 11:89667012-89667034 CAGTTGCTTTGGGGTGTAAATGG - Intergenic
1087914329 11:103791670-103791692 GAAATACTTTAGTGTGTATTTGG + Intergenic
1088614627 11:111612778-111612800 CATAAGTTTTGGGGTGTATTTGG + Intronic
1089629168 11:119773190-119773212 GAGATGCTGTGGGATGTCATGGG + Intergenic
1092105671 12:5920250-5920272 GAGCTGATTTGAGATGTATTTGG - Intronic
1092911548 12:13149472-13149494 GATATGCTTTGAAGGGTATTGGG + Intergenic
1097357320 12:58616214-58616236 GGAATGCTTTGGGCAGTATTTGG + Intronic
1098479974 12:70946197-70946219 GAGATGCTTTCCAGTGTATCTGG - Intergenic
1101333144 12:103773215-103773237 GACAAGCTGTGGGCTGTATTTGG - Exonic
1101787895 12:107901912-107901934 GAGATGGTTGTGTGTGTATTGGG - Intergenic
1102886025 12:116522530-116522552 GAGATGATTTGAGATGCATTTGG + Intergenic
1102887958 12:116535706-116535728 CAGATGCTTTTATGTGTATTAGG + Intergenic
1104387198 12:128361278-128361300 GAAATTCTTTGGGGTTTATCAGG + Intronic
1105487797 13:20854393-20854415 GAGATGCTGTGGTGTATTTTAGG - Intronic
1106584514 13:31045475-31045497 GAAATGCTTTAGGGTGTGGTCGG - Intergenic
1106585574 13:31053786-31053808 GAGATATTTTGGGGTATGTTTGG - Intergenic
1110183795 13:72648895-72648917 AAGATGGGTTAGGGTGTATTTGG - Intergenic
1115531681 14:34333720-34333742 GTGATGCTTTGGGGTGTGGGTGG - Intronic
1115650915 14:35402683-35402705 GAGATGCTTATGGCTGCATTTGG + Intronic
1118685121 14:68283324-68283346 AAGTTGCTTTGGTGTGTAGTTGG - Intronic
1118764279 14:68899642-68899664 GAGATGCGTGTGGGTGTAGTGGG - Intronic
1120854549 14:89201509-89201531 GAGGTGCTCTGGGGTCTCTTGGG - Intronic
1202834839 14_GL000009v2_random:70201-70223 GTGATGATTTAGGGTGTATCTGG + Intergenic
1125694293 15:41622165-41622187 GAGAAGCTGTGTGGTGTACTGGG + Intronic
1127785976 15:62355074-62355096 GAGCTGCTGTGGGGTGAATCAGG - Intergenic
1128258873 15:66217914-66217936 GAGAAGCTGTGGGGTGAATAGGG - Intronic
1130691589 15:86086012-86086034 GTGGTGCTTTGAGGTGTAATTGG + Intergenic
1133265699 16:4582380-4582402 GGGATGCACTGGGGTGTGTTGGG + Intronic
1135188051 16:20331983-20332005 GGGATGCTTTGTGGGGTATGGGG - Intergenic
1135526042 16:23214542-23214564 GATATGCTCTGGGGTGTAGACGG + Intronic
1143113837 17:4569674-4569696 GAGGGGCTGTGGGGTGTTTTGGG - Intergenic
1146508129 17:33423021-33423043 GAGATGCTTTTAGCTGTAGTGGG + Intronic
1146688141 17:34855575-34855597 GAGTGGGTTTGGGGTGTATGAGG - Intergenic
1148048420 17:44758006-44758028 GAGATGGTGTGGGGTGTGGTAGG - Intergenic
1151933807 17:77249089-77249111 GAGATGCTTTGTGTTGCCTTTGG - Intergenic
1153336573 18:3931458-3931480 GATATGCTTTGGCATGGATTAGG + Intronic
1155593809 18:27458971-27458993 GAGGTTCTTTGGTGTGTATGAGG + Intergenic
1156477672 18:37416476-37416498 AAGATGCTTTGGGGAATCTTGGG - Intronic
1156613932 18:38760961-38760983 GTGATGCTTTAGGGTTTCTTAGG + Intergenic
1158152599 18:54389159-54389181 GAGACCCTCTGGGGTGAATTGGG + Intergenic
1158491168 18:57910911-57910933 GAGATGCTTTGGGGAGAATGGGG + Intergenic
1158557730 18:58489149-58489171 AAGATGGTTTGGGGTTTATCTGG + Intronic
1159060068 18:63505464-63505486 GGGATGCTTTGGGGTTTTTTGGG - Intergenic
1159275137 18:66209534-66209556 AAGATGGTTTGGGGTTTATGTGG + Intergenic
1160805064 19:989083-989105 GAGATGCTCTGGGGGGTTGTGGG - Intronic
1161131729 19:2593952-2593974 GAGAAGGTTTGGGGTGAATGAGG - Intronic
1162154602 19:8668797-8668819 GGGAGGTTTTGGTGTGTATTTGG + Intergenic
1163049418 19:14670848-14670870 GAGAGGCTATGTGGTGTAATGGG - Intronic
1163554566 19:17984732-17984754 GAGATGCCTGGGGCTATATTTGG - Intronic
1164335538 19:24315414-24315436 GGGATATTTTGGAGTGTATTGGG + Intergenic
1165925183 19:39321767-39321789 AAGATGGTTTGGGGTCTAATGGG - Intergenic
1166372282 19:42308874-42308896 GAGATGTTTTGGGGTGTGGTGGG - Exonic
1202637866 1_KI270706v1_random:57492-57514 GTGATGATTTAGGGTGTATCTGG - Intergenic
925784735 2:7421041-7421063 AAGATTCTCTGTGGTGTATTTGG - Intergenic
926646813 2:15298686-15298708 GAGATGCTTTGGAATATTTTGGG - Intronic
927326045 2:21806566-21806588 GAGAGGCTTAGGGGTGAAGTAGG + Intergenic
928626972 2:33149641-33149663 GAGATGGTTTGGGATGTGATGGG + Intronic
931534467 2:63257731-63257753 GAGATGCATTTTGGTGAATTGGG + Intronic
931752640 2:65344482-65344504 GAGATGCTTAGAAGTATATTTGG - Intronic
933290813 2:80436432-80436454 GAGATGCTCTGGGGGGTGGTGGG + Intronic
935702592 2:105825171-105825193 GGGATGCTTGGGGGTGACTTAGG + Intronic
939905112 2:147903647-147903669 CAGATGTTTTGGGGTGTAATGGG - Intronic
940517012 2:154696144-154696166 GCTATGCTTTGGTGTGTATCAGG + Intergenic
945956614 2:216092207-216092229 GAGAAGCTTTGGAGTCTCTTGGG - Intronic
947521846 2:230851738-230851760 GGCATTCTTTGGTGTGTATTTGG - Intergenic
948859380 2:240745531-240745553 GAGATGCTTTGGTGTGGGGTGGG + Intronic
1169293499 20:4372633-4372655 GCAAAGCTTTGGGTTGTATTGGG + Intergenic
1169507871 20:6232746-6232768 GAGATTCTTTGGGGGCTGTTTGG + Intergenic
1170436638 20:16337406-16337428 GAGATGATCTAGGGTGTATGAGG + Intronic
1171394999 20:24826663-24826685 TCCATTCTTTGGGGTGTATTGGG - Intergenic
1171884434 20:30641584-30641606 GTGATGATTTAGGGTGTATCTGG - Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1173173277 20:40744269-40744291 GAGATGCTTTTGGGAGAAGTGGG - Intergenic
1174661786 20:52220033-52220055 GAGATGATTTGGGGAGAATGAGG + Intergenic
1174879159 20:54258345-54258367 GGGATGCTTAGAAGTGTATTTGG + Intergenic
1177553453 21:22656922-22656944 GACAAACATTGGGGTGTATTGGG - Intergenic
1178497286 21:33098094-33098116 GAGAGGCTTTGGTGAGCATTTGG + Intergenic
1178889489 21:36509329-36509351 GTGTTGCTTTGGGCTGAATTAGG + Intronic
1180138578 21:45877018-45877040 GAGATGCCTTGGAGTGTAGAAGG - Intronic
1181829844 22:25551439-25551461 GAGATGCTTTGGGCCATGTTTGG + Intergenic
1185010657 22:48311121-48311143 GAGATGCTCTGGGGTGAAGGGGG + Intergenic
950975728 3:17241874-17241896 GAGATAATTTGGGGTTTTTTTGG - Intronic
952936285 3:38400815-38400837 GAGATCCTTCGTGGTGTTTTTGG + Intronic
953367451 3:42358306-42358328 GAGATGCTTTTGTGAGGATTGGG + Intergenic
954193939 3:48984937-48984959 GAGAGACTGTGGGGTGGATTGGG + Exonic
957596971 3:82279083-82279105 GATATGCTTTCAGCTGTATTTGG + Intergenic
958567432 3:95832274-95832296 GAGATGTTTTGGTGAGTATGTGG + Intergenic
963046210 3:141104480-141104502 GAGATCCTTGGGGGTGTGTCTGG - Intronic
964632798 3:158830911-158830933 CAGATCCTTCAGGGTGTATTGGG + Intergenic
966828484 3:183985664-183985686 GAGATGCTTTGGGGCCTTTTTGG - Intronic
971584167 4:28383792-28383814 GAGACCCTTTGGGGTTTATATGG + Intronic
972045710 4:34663259-34663281 GATTGGCTTTGGGGTTTATTGGG + Intergenic
973368088 4:49223857-49223879 GTGATAATTTAGGGTGTATTTGG - Intergenic
973369005 4:49230240-49230262 GTGATGATTTAGGATGTATTTGG - Intergenic
973392037 4:49565175-49565197 GTGATGATTTAGGATGTATTTGG + Intergenic
973392961 4:49571569-49571591 GTGATAATTTAGGGTGTATTTGG + Intergenic
973547069 4:51992611-51992633 AAGATGATTTGGGGTGAATGGGG + Intergenic
975244554 4:72104548-72104570 TATATGCTTTGGGGTTTATGAGG - Intronic
975679476 4:76861751-76861773 GAGGGGCTTTGGGGTGAAATAGG + Intergenic
976194820 4:82522448-82522470 GAGATGCTTGCAGGTTTATTTGG + Intronic
976887715 4:90006678-90006700 GAGATGAGTTGGGGTATCTTAGG - Intergenic
1202765188 4_GL000008v2_random:143349-143371 GTGATGATTTAGGGTGTATCTGG - Intergenic
986762580 5:10893738-10893760 GAGATGTTTTGGGGTGGGGTGGG - Intergenic
988293838 5:29329187-29329209 GAAGTGCTTTGGGGTGGATCTGG + Intergenic
989398861 5:40987579-40987601 TAGATTCTTTGGGGGATATTAGG - Intergenic
990576442 5:57127934-57127956 AAGATGCTTTGGAATGTTTTAGG + Intergenic
994666181 5:102708381-102708403 TAGTTGCTTTGGGTTGAATTTGG - Intergenic
996034358 5:118741460-118741482 GAGTTTCTTTGGGGTTTTTTTGG + Intergenic
997304676 5:132828875-132828897 CAGCTGCTTTGGTGTGTTTTGGG + Intronic
998531711 5:142891046-142891068 GAGAAGCTTTGAGGTGTGTGGGG + Intronic
1000241448 5:159412289-159412311 AAGAAGCTTTGGGGTGTGGTGGG + Intergenic
1001394578 5:171407341-171407363 GGGATGTTATGGGTTGTATTTGG + Intronic
1001656836 5:173357433-173357455 GAGATGCTTCTGGCTGTCTTGGG + Intergenic
1005357002 6:24994643-24994665 GACATGGTTTGGGGTGTCTGTGG + Intronic
1005699779 6:28388757-28388779 GAGTTGTGTTGGGGTGTAGTAGG + Intronic
1007056191 6:38887726-38887748 AAGAGGTTTTGGGGTGGATTGGG - Intronic
1010909611 6:81537081-81537103 GAGATGATTTAGGGTATCTTTGG - Intronic
1016713713 6:147201807-147201829 GAGAGGCTTTGTGGTGTAGTGGG - Intergenic
1018500454 6:164404993-164405015 CAGCAGCTTTGGGGTGTGTTGGG - Intergenic
1019232692 6:170581706-170581728 GAGATGGTTGTGTGTGTATTGGG - Intronic
1019559672 7:1649758-1649780 GAGATTATTTGGGGTGGAGTGGG + Intergenic
1020855262 7:13413375-13413397 GAGCTGCTTTGTGGTGGAGTTGG - Intergenic
1021512568 7:21450411-21450433 TACATGCTTTGGGGTGCAATAGG + Intronic
1024387656 7:48771711-48771733 AAGATGCTTTGGGGTGGAGTAGG + Intergenic
1027964255 7:84985348-84985370 GAGATGTTTTGAGGTGTATCTGG - Intergenic
1032765285 7:134986330-134986352 GAGAGGCTTTGGGGTCTGTCGGG - Intergenic
1034355834 7:150450171-150450193 GAGGTGAGTTGGGGTGTAATGGG + Intergenic
1036630650 8:10511885-10511907 GAGATGCTTTGGGGTCTCAGAGG - Intergenic
1036923751 8:12883297-12883319 GAGATGCATTTGAGTGTATGTGG - Intergenic
1036951244 8:13141594-13141616 AAGATGCTATGGGGTGGGTTCGG + Intronic
1038442863 8:27583992-27584014 CAGATGCTCTGTGGTGTCTTGGG - Intergenic
1040103944 8:43528949-43528971 GTGATGATTTAGGGTATATTCGG + Intergenic
1040580074 8:48690448-48690470 GACATGCTTTGGGCTTTCTTGGG + Intergenic
1041644411 8:60237023-60237045 GATATGCTCTGGGGTGTGTCTGG + Intronic
1043317761 8:78942492-78942514 GAGATGCTTTTTGGAGTCTTTGG - Intergenic
1043508930 8:80931032-80931054 GAGAGGCTTTGGGGTTTCATGGG - Intergenic
1047437531 8:124847280-124847302 GGGAAGCTTTGGCGTGTGTTGGG + Intergenic
1049330806 8:142049610-142049632 GAGATGCTCTGTGGGGTCTTCGG - Intergenic
1057073466 9:92120759-92120781 GACATGCTCTGGGGTATAATAGG + Intergenic
1057581828 9:96293975-96293997 GAGATGCTGTGGACTGTAATGGG - Intronic
1057676860 9:97142722-97142744 GTGATGGTTTCGGGTGTATCTGG - Intergenic
1058611700 9:106784139-106784161 GAGATGCATTGTGGTGTTATTGG - Intergenic
1058724927 9:107793464-107793486 GTGAAGCTTTGGGATGGATTTGG + Intergenic
1059460347 9:114425658-114425680 GACATGCTCTGCAGTGTATTTGG + Intronic
1059460372 9:114425838-114425860 GAGATGCTTTGGGGTGTATTTGG - Intronic
1203545936 Un_KI270743v1:128238-128260 GTGATGATTTAGGGTGTATCTGG - Intergenic
1190568780 X:51760586-51760608 GTGATGTTTTGGCATGTATTAGG - Intergenic
1192223375 X:69212269-69212291 GAGATGCCCTGGGGTATTTTGGG + Intergenic
1193912908 X:87327569-87327591 GAGAGCTTTTGGGTTGTATTTGG - Intergenic
1196368983 X:114954172-114954194 CAGCTGCTGTGGGGTGTGTTGGG + Intergenic
1198448969 X:136747363-136747385 GACATTTGTTGGGGTGTATTTGG + Intronic
1201537639 Y:15068152-15068174 GAGGTGCTTTGGGAAGTATTGGG + Intergenic