ID: 1059460417

View in Genome Browser
Species Human (GRCh38)
Location 9:114426077-114426099
Sequence CCCACACCAGGGCCCTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 686}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059460417_1059460429 14 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460429 9:114426114-114426136 AGGAGAGCCAGGGCGGTGGAGGG 0: 1
1: 1
2: 5
3: 38
4: 511
1059460417_1059460433 22 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460433 9:114426122-114426144 CAGGGCGGTGGAGGGATGGGAGG 0: 1
1: 0
2: 5
3: 97
4: 892
1059460417_1059460427 10 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460427 9:114426110-114426132 TGAGAGGAGAGCCAGGGCGGTGG 0: 1
1: 0
2: 3
3: 49
4: 500
1059460417_1059460431 19 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460431 9:114426119-114426141 AGCCAGGGCGGTGGAGGGATGGG 0: 1
1: 0
2: 1
3: 45
4: 434
1059460417_1059460424 3 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460424 9:114426103-114426125 TGCAGGCTGAGAGGAGAGCCAGG 0: 1
1: 0
2: 0
3: 59
4: 639
1059460417_1059460425 4 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460425 9:114426104-114426126 GCAGGCTGAGAGGAGAGCCAGGG 0: 1
1: 0
2: 6
3: 73
4: 579
1059460417_1059460426 7 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460426 9:114426107-114426129 GGCTGAGAGGAGAGCCAGGGCGG 0: 1
1: 0
2: 7
3: 98
4: 874
1059460417_1059460430 18 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460430 9:114426118-114426140 GAGCCAGGGCGGTGGAGGGATGG 0: 1
1: 0
2: 4
3: 73
4: 786
1059460417_1059460423 -6 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460423 9:114426094-114426116 TGTGGGGACTGCAGGCTGAGAGG 0: 1
1: 0
2: 9
3: 56
4: 453
1059460417_1059460428 13 Left 1059460417 9:114426077-114426099 CCAATGGAGGGCCCTGGTGTGGG 0: 1
1: 0
2: 6
3: 44
4: 686
Right 1059460428 9:114426113-114426135 GAGGAGAGCCAGGGCGGTGGAGG 0: 1
1: 0
2: 5
3: 58
4: 714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059460417 Original CRISPR CCCACACCAGGGCCCTCCAT TGG (reversed) Intronic