ID: 1059461585

View in Genome Browser
Species Human (GRCh38)
Location 9:114434223-114434245
Sequence CTGCTGTCATCTATGAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059461585_1059461588 11 Left 1059461585 9:114434223-114434245 CCGTGTTTCATAGATGACAGCAG 0: 1
1: 0
2: 1
3: 25
4: 288
Right 1059461588 9:114434257-114434279 GAGGTGAAGCTACTTGCCCAAGG No data
1059461585_1059461587 -8 Left 1059461585 9:114434223-114434245 CCGTGTTTCATAGATGACAGCAG 0: 1
1: 0
2: 1
3: 25
4: 288
Right 1059461587 9:114434238-114434260 GACAGCAGTGAGGCTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059461585 Original CRISPR CTGCTGTCATCTATGAAACA CGG (reversed) Intronic
904445957 1:30573105-30573127 ATGTTCTCATCTATGAAATAGGG + Intergenic
904468741 1:30723121-30723143 CTGCTGTCATCAAAGAGCCATGG + Intronic
906463644 1:46057201-46057223 CTGCTGCCATCCATGTAAGACGG + Intronic
907245984 1:53109516-53109538 CTGGAGTCATCTTTGAGACAAGG + Intronic
908735568 1:67272740-67272762 CTGCTATCATCAATGACATAGGG - Intergenic
909292612 1:73902706-73902728 CTGATGACATATATGCAACATGG - Intergenic
909703238 1:78551687-78551709 CTGCTGCCATCCATGTAAGATGG + Intergenic
912012404 1:104983866-104983888 CTGCTGTCATCCATGTAAGATGG + Intergenic
912165815 1:107040826-107040848 CTGCTGCCATCCATGTAAGATGG + Intergenic
912801679 1:112723332-112723354 CTTTTCTCATCTATGACACAGGG - Intronic
913172656 1:116246655-116246677 CTGATTTCATCCATCAAACATGG - Intergenic
916509598 1:165460277-165460299 ATGCTCTCATCTATGAAATATGG + Intergenic
917197481 1:172481736-172481758 ATGCTGTCATCTATGGAAATGGG + Intergenic
917326717 1:173840633-173840655 TTGGTTTCATCTATGAAATAGGG + Intronic
917385999 1:174474913-174474935 TTTCTGTCATCTATAAAGCAGGG + Intronic
917681687 1:177374491-177374513 CTGCTGCCATCCATGTAAGATGG - Intergenic
918125131 1:181576889-181576911 CTTCTGTCATCTCTAAAATAAGG - Intronic
918294469 1:183143137-183143159 CTGCTGGTATCGATGAGACAGGG - Exonic
918654992 1:187013953-187013975 CTGCTGGCATCTATGAAACTGGG - Intergenic
918867913 1:189926917-189926939 CTGCTGTCATTTATGGAGGATGG - Intergenic
920442063 1:205987699-205987721 TTGCTGGCATCTATGCTACAAGG - Intronic
921185226 1:212664740-212664762 TTGTTATCATCTATGAAACTAGG + Intergenic
922636504 1:227178354-227178376 CTGCTGCCATCCATGTAAGATGG + Intronic
924421713 1:243916283-243916305 CAGATTTCACCTATGAAACAGGG - Intergenic
1062815132 10:493816-493838 AGACTGTCATCTGTGAAACAAGG - Intronic
1062997802 10:1883224-1883246 TTACTGTCATTTTTGAAACAGGG + Intergenic
1063529242 10:6814964-6814986 CTGTTTTCACGTATGAAACAGGG + Intergenic
1063680607 10:8184047-8184069 CTGCTGTATTCTATGAGAAATGG - Intergenic
1064222356 10:13452256-13452278 ATGCTGTCATATATGAAAACCGG - Intronic
1065494129 10:26311730-26311752 GTTCTGTCATCTGTAAAACAGGG + Intergenic
1065672125 10:28131318-28131340 CTGTTGACATTTATGAAAGAAGG - Intronic
1066506759 10:36053424-36053446 CTGTTCTTATCTATGAAATAAGG - Intergenic
1068037779 10:51782759-51782781 CTGCTGCCATCCATGTAAGACGG + Intronic
1068479036 10:57565280-57565302 ATTCTGTCATTTGTGAAACATGG - Intergenic
1069102830 10:64344499-64344521 CTACTAGCATCCATGAAACATGG + Intergenic
1069258513 10:66363951-66363973 GTTCTGTCATCTGTAAAACAAGG - Intronic
1069326969 10:67243042-67243064 TTGCTGTCATCTAAGAAAACAGG - Intronic
1069856072 10:71441785-71441807 CTGCTTTCCTCTGTGAGACACGG + Intronic
1071765927 10:88665357-88665379 GTGTTCTCATCTATAAAACAGGG - Intronic
1075572890 10:123558389-123558411 CTGCTGCCATCTCTGAACCTCGG - Intergenic
1075853890 10:125611437-125611459 CTGTTGTCATCAAAGACACATGG - Intronic
1076809200 10:132878069-132878091 CTGCTGTCATCAAAGAAACCTGG + Exonic
1078533476 11:12154996-12155018 AAGCTGTCTTCTATCAAACAAGG + Intronic
1078858644 11:15227206-15227228 CTGCTGTCATCTTTGAAGAAAGG + Intronic
1079491035 11:20989524-20989546 CTGCTGTCAAGTATGAAATGAGG - Intronic
1079686126 11:23362215-23362237 CTGCTGCCATCCATGTAAGATGG - Intergenic
1079863739 11:25708364-25708386 CTGCTGCCATCTACAAAAAATGG + Intergenic
1080088720 11:28317848-28317870 CTGATATCATACATGAAACAGGG + Intronic
1080099609 11:28444634-28444656 ATGTTTTCATCTATGAAATAGGG + Intergenic
1080182892 11:29445500-29445522 CTGCTGCCATCCATGTAAGATGG + Intergenic
1082641190 11:55663577-55663599 CTGCTGGCATCTCCGAAACCTGG - Intergenic
1083728075 11:64638554-64638576 CAGCTGTCTTCTAGGAGACACGG + Intronic
1085998653 11:81952527-81952549 CTTGTGTCCTCTTTGAAACAAGG - Intergenic
1086503971 11:87482963-87482985 CTGGTGACTTCTATGAAACATGG - Intergenic
1087193652 11:95283016-95283038 CTGCTGACATCAATGAAAAGGGG + Intergenic
1087556793 11:99731450-99731472 CTGCAATCATCTTTAAAACAAGG - Intronic
1088443994 11:109902976-109902998 CTGCTGCCATCCATGTAAAATGG - Intergenic
1092796821 12:12119546-12119568 CTGCTGTCATGTATGGTACTGGG - Exonic
1099091836 12:78320807-78320829 CTGCTGCCATCCATGTAAGATGG + Intergenic
1099654929 12:85478300-85478322 CTGCTGCCATCCATGTAAGACGG - Intergenic
1100758713 12:97781822-97781844 CTGCTGCCATCCATGTAAGATGG + Intergenic
1100972851 12:100089992-100090014 CTGCTGCCATCCATGTAAAATGG + Intronic
1102198047 12:111038300-111038322 CTGCTGTCATCTATAGAAAGAGG - Intronic
1103244395 12:119443848-119443870 CTGCCCTCATCTATGAAATGGGG + Intronic
1104871411 12:132000968-132000990 CTGCTGTCGTTTATGAATCCTGG + Intronic
1105486443 13:20837736-20837758 CTGCTGCCATCCATGTAAGACGG - Intronic
1105988797 13:25597163-25597185 CAACAGACATCTATGAAACAGGG - Intronic
1107344088 13:39440605-39440627 TTGCTGTCATTTTTGAGACAGGG + Intronic
1107678090 13:42817856-42817878 CTGCTGCCATCCATGTAAGATGG - Intergenic
1108767313 13:53648158-53648180 CTGCTGGCATTTATGTTACATGG - Intergenic
1109672193 13:65623726-65623748 CTGCTGCCATCTATAAAACTTGG - Intergenic
1109776942 13:67053051-67053073 CTACTGGCTTCTCTGAAACAAGG - Intronic
1109918769 13:69027578-69027600 ATGCTTCCATCTATGAAACCTGG - Intergenic
1110622888 13:77618593-77618615 CTCCTGTCAACAAGGAAACAAGG + Intronic
1111236872 13:85420477-85420499 CAACTTTCTTCTATGAAACAGGG - Intergenic
1112259435 13:97864657-97864679 CTGCTGCCATCCATGTAAGACGG - Intergenic
1112956607 13:105066909-105066931 CTGGTGCCATCTTTAAAACAAGG + Intergenic
1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG + Intronic
1118906940 14:70030087-70030109 CTGCTGTCCTCTATGAGGCTAGG - Intronic
1118920756 14:70147748-70147770 CTGCTGTCTTATCTGAAGCATGG - Intronic
1119053939 14:71399409-71399431 CTGCTGTTGTTTTTGAAACAGGG + Intronic
1119726894 14:76926868-76926890 CTGCTGTCACCATGGAAACAAGG - Intergenic
1120337379 14:83174228-83174250 CTGCTGTCATCCATGTAAGATGG - Intergenic
1120939600 14:89934551-89934573 CGGCTGTCTTCTAGGCAACAGGG + Intronic
1122228257 14:100292084-100292106 GTGTTCTCATCTATGAAATAAGG - Exonic
1124140641 15:27074035-27074057 CTGCTGCCATCCATGTAAGATGG - Intronic
1125053436 15:35328898-35328920 CTGCTGCCATCCATGTAAGATGG - Intronic
1126942227 15:53779793-53779815 CTGCTGCCATCTATGTAAGATGG + Intergenic
1127481587 15:59382845-59382867 CTGATGCCATGTAGGAAACATGG + Intronic
1129717788 15:77862192-77862214 CTGCTGTCATCCAGGGGACAGGG + Intergenic
1130460981 15:84158069-84158091 CTGCTGTCATCCAGGGGACAGGG - Intergenic
1131213644 15:90519063-90519085 CTGCAGTCATCCATGAAAATAGG + Intergenic
1131993380 15:98111683-98111705 CTTTTGTCATCTCTGAAACAAGG - Intergenic
1132119008 15:99160196-99160218 CTTCTGTCAGCTAGGGAACACGG - Intronic
1133132664 16:3687268-3687290 CTGCTGTCATCCATGTAAGACGG + Intronic
1137507605 16:49068066-49068088 CTGATGACAACTGTGAAACAAGG - Intergenic
1137577024 16:49606814-49606836 CTCCTGCCATCTCTGAAACAAGG + Intronic
1139794813 16:69473938-69473960 CTGCTGCCATCCATGTAAGACGG - Intergenic
1140963395 16:79939996-79940018 CTCCTGTCATCTGGCAAACACGG - Intergenic
1141259619 16:82440689-82440711 TTGCTCTTATCTATGTAACAGGG + Intergenic
1142482201 17:225935-225957 GTTCTGTCATCTATCACACATGG + Intronic
1142484665 17:238925-238947 CTGCTGTCATATATGAGCAATGG + Intronic
1146374006 17:32282213-32282235 CAGATGTCATCCATGAAACCTGG + Intronic
1146548260 17:33757641-33757663 CTCCTGTTTTCTATAAAACATGG - Intronic
1147446287 17:40477171-40477193 CTGCTGTCTGCCACGAAACAGGG + Exonic
1147893105 17:43731371-43731393 CTGCTGCCATCCATGTAAGACGG + Intergenic
1149347419 17:55752062-55752084 TTGCTTTCACCTATGAAACCTGG - Intronic
1151105971 17:71617791-71617813 CTGCTGCCATCTATGTAAGATGG + Intergenic
1152065526 17:78110701-78110723 CTGCTCTCATCGAGCAAACATGG + Exonic
1152370345 17:79884045-79884067 CTGCTGCCATCCATGTAAGACGG + Intergenic
1153136982 18:1928466-1928488 CTGCTGCCATCTTTGTAAGATGG + Intergenic
1153228850 18:2918440-2918462 CAGATGGCATCTATGAAATAAGG + Exonic
1153323140 18:3792881-3792903 CTGCTGCCATCTGTGAAGCCTGG + Intronic
1153917163 18:9756464-9756486 CTGCTGTAATCTCTTAATCAGGG - Intronic
1154195129 18:12259926-12259948 CTGCTGGCATCTAAGCACCATGG - Intronic
1154366806 18:13717871-13717893 CTGCTGGCCTCAAGGAAACAAGG + Intronic
1154438467 18:14365112-14365134 GTTTTGTCTTCTATGAAACAAGG + Intergenic
1155090914 18:22510158-22510180 CTGCTGCCATCCATGTAAGATGG - Intergenic
1155172515 18:23277345-23277367 CTGCTGCCATCTATGTAAGATGG + Intronic
1155175613 18:23298809-23298831 CTGCTGGCACCTCTGAAAAAGGG - Intronic
1155773171 18:29725665-29725687 CTGCTGCCATCCATGTAAAATGG - Intergenic
1156159129 18:34338688-34338710 CTTCTGTCATCTGTTAAACCAGG - Intergenic
1156593057 18:38513150-38513172 CTGCTGTCATCCATGTAAGATGG + Intergenic
1156782264 18:40864929-40864951 CAACTGTGAACTATGAAACAGGG - Intergenic
1156808933 18:41224004-41224026 CTGCTGCCATCCATGTAAGATGG + Intergenic
1157443798 18:47729845-47729867 CTGCTGTCATCCCTGAAGCTGGG - Intergenic
1158056170 18:53283855-53283877 CTGCTGTCTTTTATGAAGCAAGG - Intronic
1158063490 18:53376746-53376768 CTGCTGTCATATTTGATATAGGG - Intronic
1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG + Intronic
1159282279 18:66301576-66301598 CTGCTGCCATCCATGTAAGATGG + Intergenic
1159433224 18:68383317-68383339 CTGCTGCCATCCATGTAAGATGG + Intergenic
1159821053 18:73144067-73144089 CTGCAGTCATGTATGTTACAGGG - Intergenic
1159913016 18:74164422-74164444 CTGCTGTCAGCTAGGAAATTAGG + Intergenic
1159925423 18:74264756-74264778 CTGCTTTAATATGTGAAACAAGG + Intronic
1160375019 18:78405267-78405289 CTGCTGCCATCCATGTAAGACGG - Intergenic
1165183763 19:33998365-33998387 CTTCTGTTTTCTATGAAGCAAGG - Intergenic
1165230650 19:34384464-34384486 CAGGTGACATCTATGAAACCAGG + Intronic
1166173786 19:41051037-41051059 CAGCTCCCATCTGTGAAACAGGG - Intergenic
925200192 2:1960942-1960964 GTGATGTCATCTGTGCAACATGG - Intronic
925303284 2:2832063-2832085 GTGCTGTGATCTATAACACAAGG - Intergenic
926463293 2:13160743-13160765 CTGCTTTCATCCACCAAACAAGG - Intergenic
927245518 2:20954470-20954492 CTGCTGCCATCCATGTAAGATGG - Intergenic
928019992 2:27696766-27696788 ATTCTGTCATCTGTGAAGCAGGG + Intergenic
930145764 2:48002759-48002781 CTGCAGGCTTCTATGAGACATGG - Intergenic
931033644 2:58212205-58212227 CTGCTGCCATCCATGTAAGATGG - Intronic
931262277 2:60630774-60630796 CTGCTGCCATCCATGTAAGATGG + Intergenic
931654498 2:64498702-64498724 CAGAAGTCATCTATGAAAGATGG + Intergenic
932519871 2:72399769-72399791 GTTGTGTCATCTATGACACAAGG - Intronic
932854676 2:75220679-75220701 CTGCTGCCATCCATGTAAGACGG + Intergenic
933143256 2:78820077-78820099 CTGTTGCCATCTAGAAAACAAGG - Intergenic
934971335 2:98766795-98766817 CTTTTCTCATCTATAAAACAGGG + Intergenic
935517043 2:104052713-104052735 CAGCTGTAAACTATGAAAAAGGG + Intergenic
937711336 2:124983746-124983768 CTTCTCTCATCTATAAAAAAGGG + Intergenic
941509509 2:166388136-166388158 ATGTTGTCATTTATGAAAAATGG + Intergenic
944831022 2:203534668-203534690 CTGAACTCATCTATGAAAGATGG + Intronic
946245818 2:218386837-218386859 CTGCTGTCCCCTCTGAAGCAGGG + Intronic
947219202 2:227776820-227776842 CTGTTTTCATCAATGCAACATGG - Intergenic
947477429 2:230463144-230463166 GTTCTCTCATCTAGGAAACAAGG - Intronic
947519114 2:230830148-230830170 GTGCTTTCATCCATCAAACAGGG - Intergenic
948164704 2:235852039-235852061 CTGCTGCCGACTCTGAAACAAGG + Intronic
1169218588 20:3807498-3807520 CTGCTTTCGTCTGTGAAACCAGG - Intergenic
1170383549 20:15789435-15789457 TTGCTGTCATATAAGAAAAATGG - Intronic
1170784586 20:19456451-19456473 CTGCTGCCATCCATGTAAGACGG + Intronic
1172325879 20:34034105-34034127 CTGCTGTCATCTCTTGAAGAAGG + Intronic
1176457208 21:6924360-6924382 GTTTTGTCTTCTATGAAACAAGG - Intergenic
1176835381 21:13789444-13789466 GTTTTGTCTTCTATGAAACAAGG - Intergenic
1176944839 21:14966907-14966929 CTGCTGTCATCTGTAAAACTAGG + Exonic
1177288059 21:19076906-19076928 CTGCTGCCATCCATGTAAGATGG + Intergenic
1177387785 21:20429689-20429711 CTGCTGCCATCTCTGTAAGATGG + Intergenic
1177936829 21:27358770-27358792 ATGCTGTCATGTGTAAAACAAGG + Intergenic
1179316807 21:40251073-40251095 CTTCTGTCATCAATGAAATATGG + Intronic
1180044034 21:45294594-45294616 CTGCCGTCATCTGGGAAACGTGG + Intergenic
1181138471 22:20786300-20786322 CAGCTGGCATCCATGAAACTAGG - Intronic
1182078388 22:27510996-27511018 CTGCTTTCATCTATAAAAGGGGG - Intergenic
1182863194 22:33579285-33579307 CTGCTGCCATCCATGTAAGATGG + Intronic
1182957947 22:34444966-34444988 CTGGTTTCATTTATCAAACAAGG - Intergenic
1183043451 22:35200880-35200902 CTGCTGCCATCCATGTAAGATGG + Intergenic
1184266275 22:43348356-43348378 CTGCTGCCATCCATGTAAGATGG - Intergenic
1184352229 22:43951972-43951994 CTGCTGTCATCTCTGGAATCTGG + Intronic
1184505243 22:44896839-44896861 TTTCTGTCACTTATGAAACAGGG + Intronic
1185263899 22:49887399-49887421 GTCCTGTCAACTATGAAATATGG + Exonic
950434618 3:12971498-12971520 CTGCTGCCATCTTTTTAACATGG - Intronic
952075829 3:29696554-29696576 CAGCAGTCATCTATGAGACAGGG - Intronic
952741628 3:36739565-36739587 CTGCTGCCATCCATGTAAGATGG + Intronic
955348154 3:58176027-58176049 CTGCTCTCATCTGTAAAATACGG + Intergenic
956140391 3:66140731-66140753 CTTCTGTCATCTGAGAAACTGGG - Intronic
956298767 3:67745514-67745536 CTGCTGTCGTCCAAGAAAGATGG + Intergenic
956798939 3:72739519-72739541 CTGATGTCACCCATGCAACAAGG - Intergenic
959316901 3:104820946-104820968 CTGCTGACATCCATGTAAGATGG + Intergenic
959324748 3:104922430-104922452 CTGCTGCCATCCATGTAAGACGG + Intergenic
960626369 3:119685892-119685914 CTGCTGCCATCCATGTAAGATGG - Intergenic
961118278 3:124350397-124350419 GTGTTGTCTTCTATAAAACAAGG - Intronic
961206825 3:125089974-125089996 CTGCTTTCTTCTTTGAATCATGG + Intronic
961911024 3:130316718-130316740 CTGCTGTCATATAGAAAAGAAGG + Intergenic
962235486 3:133703463-133703485 CTGCTTTCATTTATAAAAGAGGG + Intergenic
963231249 3:142910675-142910697 ATGCTGTCCTCTCTGAAACCAGG + Intergenic
964682703 3:159359961-159359983 GTGCTGTCAGCTAACAAACAAGG - Intronic
965384960 3:168034847-168034869 CTGCTGCCATCCATGGAAGATGG + Intronic
966717609 3:183029553-183029575 CTGCTGGGTTCTGTGAAACATGG + Intronic
968137632 3:196230395-196230417 CTGCTGGCAACTAGGAAACTAGG - Intronic
969943444 4:10758574-10758596 CTGATTTCATCTGTAAAACAAGG - Intergenic
970370035 4:15397024-15397046 CTGCTGCCATCCATGTAAGACGG - Intronic
971705916 4:30042597-30042619 CTGCTGTGATATAAGAACCAAGG - Intergenic
971714297 4:30155471-30155493 TTGGTGTCATCTATGAGGCACGG - Intergenic
973587497 4:52408254-52408276 CTGCTGTCATCACTCTAACATGG + Intergenic
973933854 4:55821698-55821720 ATTCTGTCATGTAAGAAACAAGG + Intergenic
974241562 4:59255326-59255348 CCCCTGTTATCTAGGAAACAGGG - Intergenic
976033686 4:80790248-80790270 CTGCTGTGAGCTAGGAAACATGG - Intronic
976937289 4:90652040-90652062 CTGCTAGCATTTATGAAACTGGG + Intronic
977695246 4:99957529-99957551 CTGCTGCCATCCATGTAAGATGG + Intergenic
978463169 4:108980130-108980152 ATTCTGTCATCAATGTAACAAGG + Intronic
979391755 4:120137231-120137253 CTGCTGCCATCCATGTAAGATGG - Intergenic
979455070 4:120917950-120917972 CCTCTCTCATCTATAAAACAGGG + Intronic
979699726 4:123654332-123654354 CTGCTGCCATCCATGCAAGATGG + Intergenic
981581290 4:146250936-146250958 GTCTTGTCATCTATAAAACAGGG + Intergenic
984782736 4:183540588-183540610 CTGCTCTCAGCTGTCAAACATGG + Intergenic
985345003 4:188994836-188994858 CTCCTGTCATATGTGATACATGG - Intergenic
986221953 5:5776119-5776141 CTGCTGCCATCCATGTAAAATGG + Intergenic
986852590 5:11830503-11830525 CTGCTGCCATCCATGTAAGATGG + Intronic
987208717 5:15656435-15656457 CTGCTGCCATCCATGTAAGACGG - Intronic
988441334 5:31237104-31237126 CAGCTGTCCTCTCTGAAACACGG - Intronic
988865622 5:35331287-35331309 CTGCTGCCATCTATGTAAGATGG + Intergenic
990525943 5:56628019-56628041 CTGCTGCCATCCATGTAAGATGG + Intergenic
992061904 5:73059369-73059391 CTTTTTTCATCTATAAAACAGGG - Intronic
992554562 5:77890694-77890716 CTGCTTTCTTCTATGAAGCTAGG + Intergenic
992651392 5:78864323-78864345 CTGCTGCCATCCATGTAAGATGG - Intronic
992848354 5:80777971-80777993 CTTTTCTCATCTATGAAACGGGG - Intronic
993121554 5:83780604-83780626 CTGCTGTCATAGATGTAAAATGG - Intergenic
993589289 5:89774661-89774683 CTGCTGATATTTTTGAAACAAGG + Intergenic
993596868 5:89868204-89868226 TTGCTCTCATCTATAAAATAGGG + Intergenic
994284966 5:97953928-97953950 CTTTTGTCATCTATGAAATATGG + Intergenic
994341979 5:98640880-98640902 CTTTTGTCATCTATAAAATAGGG + Intergenic
994495850 5:100512401-100512423 CTGCTTTCACCAATGGAACATGG + Intergenic
994850113 5:105044019-105044041 CTGCCAGCATCCATGAAACATGG + Intergenic
996031063 5:118704225-118704247 CTGCTGCCATCCATGTAAGATGG - Intergenic
996411432 5:123163481-123163503 CTGCTGTCTTCTCTGAGTCAAGG - Intronic
996764231 5:127019687-127019709 GTGATGTCATCAAGGAAACAGGG - Intronic
997887981 5:137648488-137648510 TTGCTGCCATCTGTGGAACAGGG + Intronic
998744208 5:145238280-145238302 CTACTGTCATCTGTGAAATGGGG - Intergenic
998952752 5:147408203-147408225 CTGCTGACATCTCGGAGACATGG + Intronic
1000713647 5:164612303-164612325 CTGCTGATTTCTCTGAAACAAGG - Intergenic
1000993570 5:167935725-167935747 CTGCTGGCATTCATGACACAGGG + Intronic
1001868962 5:175133649-175133671 CTTCTGTCATTTATGTAAGATGG - Intergenic
1002864185 6:1106984-1107006 AAGCTGCCATCTATGAAGCAGGG - Intergenic
1003848868 6:10201710-10201732 CAGCTGTCTTCTATTAAGCAAGG - Intronic
1004071058 6:12298307-12298329 GTTTTCTCATCTATGAAACAAGG + Intergenic
1004269677 6:14183562-14183584 CTGCAGTCACCTATGAATGAAGG - Intergenic
1004656471 6:17666971-17666993 CTGATAACATCTGTGAAACATGG + Intronic
1004990994 6:21138525-21138547 CATTTGTCATCTGTGAAACAGGG + Intronic
1005130169 6:22497698-22497720 CTGCTTACATATATTAAACATGG - Intergenic
1006263525 6:32896144-32896166 CTGCTGGGATGCATGAAACATGG - Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009517724 6:64641214-64641236 CTGCTGCCATCTGTGCAAGAAGG - Intronic
1010086875 6:71930510-71930532 CAGTTTTCATCTATAAAACAAGG - Intronic
1010714296 6:79210334-79210356 CTGCTGTAGTTTATGAGACATGG - Intronic
1010920504 6:81674174-81674196 CTGCTGCCATCCATGTAAGATGG - Intronic
1011123574 6:83982184-83982206 CTGCTGCCATCCATGTAAGAAGG - Intergenic
1014826657 6:126054832-126054854 CTGCTGTCTTCTGAGACACAGGG + Intergenic
1017824024 6:158068634-158068656 CTGCTGTCATCTGGGGAGCAAGG - Exonic
1017980708 6:159399041-159399063 CTGCTGGCATCTCTGCCACAGGG + Intergenic
1018578959 6:165290946-165290968 CTGCTGCCATCCATGTAAGATGG - Intronic
1018949708 6:168371128-168371150 TTTCTGTCATCTTTGAAAGAAGG + Intergenic
1019190372 6:170247403-170247425 CTGATGTCATCAATCACACACGG - Intergenic
1022322249 7:29298081-29298103 CGGCTTTCACCTATGAAGCAGGG + Intronic
1022821971 7:33970904-33970926 TTGCTGTCAGCTAGGAAGCAGGG - Intronic
1024088071 7:45913334-45913356 GTGGTGTCATTTCTGAAACAAGG - Intronic
1029031235 7:97469343-97469365 TTGCTGCCATGTATGTAACATGG + Intergenic
1029936328 7:104428371-104428393 TTGTTGTCATCTCTGAAAAAAGG - Intronic
1030027308 7:105337096-105337118 CTGGTGTCATCTAAAAATCAAGG - Intronic
1030534926 7:110754314-110754336 CCCCGGTCATCTATGAAATAAGG - Intronic
1031248060 7:119342320-119342342 CTTTTGTCTTCTATAAAACAAGG - Intergenic
1032771238 7:135059416-135059438 CTATTCTCATCTATAAAACAAGG - Intronic
1035321792 7:158034496-158034518 CTGCTGCCATCCATGTAAGACGG + Intronic
1037567843 8:20132535-20132557 GTGTCTTCATCTATGAAACAGGG - Intergenic
1038769600 8:30465171-30465193 ATGCTGTCAAATAAGAAACATGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041471736 8:58217409-58217431 ATGCTGTCATCCAAGAAATACGG - Intergenic
1043088598 8:75869516-75869538 CTGCTGTCATCCCTGTAAGACGG - Intergenic
1044227313 8:89734367-89734389 CTGCTGCCATCCATGTAAGACGG - Intergenic
1045353261 8:101361737-101361759 CTGCTGTCTTTTATCAGACAGGG + Intergenic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1047071667 8:121351846-121351868 CAGCTGTCTTCTATTAAACCAGG - Intergenic
1047584342 8:126253528-126253550 CTGATTTTATCTATGAAATATGG + Intergenic
1048541217 8:135343836-135343858 TTACTGTCATCTAGTAAACAGGG - Intergenic
1048677129 8:136795584-136795606 CTGCTATCATCTACCAAACTTGG - Intergenic
1049076452 8:140400047-140400069 CTGCTGCCATCCATGTAAGACGG + Intronic
1049834489 8:144725847-144725869 ATCCTGTCATATATGTAACAAGG + Intronic
1050264180 9:3872515-3872537 CTGCTGCCATCCATGTAAAATGG - Intronic
1050488678 9:6163888-6163910 CTTTTCTCATCTGTGAAACAGGG + Intergenic
1050502435 9:6313249-6313271 CTGCTGCCATCCATGTAAGATGG - Intergenic
1050984836 9:12069465-12069487 TTACTATCATCTGTGAAACATGG - Intergenic
1050989093 9:12124270-12124292 CTGTATTCATCCATGAAACATGG - Intergenic
1051083336 9:13318320-13318342 CAGCTGTCATATATGGAAAAAGG - Intergenic
1053482393 9:38425135-38425157 CTCTTGTCATCTGTGAAACTGGG + Intergenic
1055716990 9:79128632-79128654 GTGCTCTCATCTATAAAAGAGGG - Intergenic
1056832251 9:89926682-89926704 GTGCTTTCCTCTATGAAGCAGGG + Intergenic
1059461585 9:114434223-114434245 CTGCTGTCATCTATGAAACACGG - Intronic
1059738768 9:117128837-117128859 CTGCTGCCATCCATGTAAGATGG - Intronic
1186225553 X:7395554-7395576 TTGTTCTCATCTCTGAAACAGGG + Intergenic
1186546157 X:10451750-10451772 CTGCTGCCATCCATGTAAGACGG + Intronic
1187759301 X:22562507-22562529 CTGTTGTCCTCTCTGAAACCTGG - Intergenic
1187793656 X:22978108-22978130 GTGGTGTCATCTTTGTAACAGGG + Intergenic
1187853453 X:23613820-23613842 CTGCTGCCACCTATGTAAGACGG - Intergenic
1189275019 X:39779172-39779194 CTGCTGTCATGTATGAATCCCGG + Intergenic
1192219434 X:69187286-69187308 CTGCTTCTGTCTATGAAACATGG - Intergenic
1192262550 X:69514711-69514733 CTGCTGTTATGTATGTAAAATGG - Intronic
1193131199 X:77921535-77921557 ATTTTTTCATCTATGAAACAGGG + Intronic
1194051857 X:89079146-89079168 TTTCTGCCATCTAGGAAACAAGG - Intergenic
1194554599 X:95341416-95341438 CTGCTGCCATCCATGTAAGATGG + Intergenic
1194554736 X:95342298-95342320 CTGCTGCCATCCATGTAAGATGG + Intergenic
1196169666 X:112573837-112573859 CTGCTGCCATCCATGTAAGATGG + Intergenic
1196169928 X:112575765-112575787 CTGCTGCCATCCATGTAAGACGG + Intergenic
1196278688 X:113797678-113797700 CTGCTGCCATCCATGTAAGATGG + Intergenic
1200046399 X:153404986-153405008 CAGATGACATCTATGAAACCAGG - Intergenic
1201595169 Y:15660179-15660201 TTGTTCTCATCTCTGAAACAGGG + Intergenic