ID: 1059463262

View in Genome Browser
Species Human (GRCh38)
Location 9:114448861-114448883
Sequence CTGTGGGTGAGGAAGTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059463262_1059463268 -1 Left 1059463262 9:114448861-114448883 CCTTGTCACTTCCTCACCCACAG 0: 1
1: 0
2: 2
3: 46
4: 358
Right 1059463268 9:114448883-114448905 GTACCTGGGAGCATAACTTGTGG No data
1059463262_1059463271 28 Left 1059463262 9:114448861-114448883 CCTTGTCACTTCCTCACCCACAG 0: 1
1: 0
2: 2
3: 46
4: 358
Right 1059463271 9:114448912-114448934 TACATCCCTAAGTCCTGTGGTGG No data
1059463262_1059463270 25 Left 1059463262 9:114448861-114448883 CCTTGTCACTTCCTCACCCACAG 0: 1
1: 0
2: 2
3: 46
4: 358
Right 1059463270 9:114448909-114448931 CTATACATCCCTAAGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059463262 Original CRISPR CTGTGGGTGAGGAAGTGACA AGG (reversed) Intronic
900561114 1:3307274-3307296 CTGCTGGTGGGGAGGTGACATGG - Intronic
901188555 1:7390135-7390157 CAGAGGGTGGGGAAGTGACTGGG - Intronic
901465190 1:9416901-9416923 CTGTGGCTGAGGGAGGCACAGGG - Intergenic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902414590 1:16231399-16231421 CTGTGGGGGAGGCTGGGACATGG - Intergenic
902618313 1:17635855-17635877 CTGTGGGTGAGAAAGGCACTGGG + Intronic
902635428 1:17731978-17732000 GTGTGTGTGTGTAAGTGACAGGG - Intergenic
903047470 1:20575467-20575489 CTGATGGGGAGGAAGTGACAGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
905263679 1:36736589-36736611 CTGGGGGAGGGGAGGTGACAAGG + Intergenic
905862054 1:41358347-41358369 CTGGAGGAGGGGAAGTGACAGGG + Intergenic
906109040 1:43311437-43311459 TGGTAGATGAGGAAGTGACATGG - Intronic
906164803 1:43678254-43678276 CTGTGGGTGTGGGAGTCACCAGG + Intronic
906312401 1:44763256-44763278 CTGTGGAAGAGCAAGTGACTGGG + Intronic
906778474 1:48551071-48551093 TTGTAGGTCAGGAAGTGACAAGG - Intronic
907398757 1:54211058-54211080 CAGAAGGAGAGGAAGTGACAAGG - Intronic
907762496 1:57375192-57375214 CTGTGGGGGAGGAAATGAGTGGG - Intronic
908299515 1:62749722-62749744 TTGTGGGTTAGGAATTGCCATGG + Intergenic
908868270 1:68576737-68576759 CTGAGGGTGTGGAAGTACCAGGG - Intergenic
912868472 1:113280991-113281013 TTGTAAGTAAGGAAGTGACATGG + Intergenic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
913967146 1:143385737-143385759 GGGTGGGTGAGGAAGTGAGCAGG + Intergenic
914061523 1:144211344-144211366 GGGTGGGTGAGGAAGTGAGCAGG + Intergenic
914117627 1:144755025-144755047 GGGTGGGTGAGGAAGTGAGCAGG - Intergenic
915433378 1:155884346-155884368 CAGTGGGTGCTGAGGTGACAGGG + Exonic
918367949 1:183828893-183828915 CTATGGGTGAGGAAGAGAGTTGG + Intronic
918406372 1:184215185-184215207 CTGGGGGTGAGGAACTGAGGGGG - Intergenic
919610923 1:199744800-199744822 CTGTGGTTGATGAAGAGGCAGGG + Intergenic
920542040 1:206786011-206786033 CTTGGGGTGGGGAAGTGAAAGGG + Intergenic
920678487 1:208055196-208055218 CGGTGGGAGAGACAGTGACACGG + Intronic
920771717 1:208892787-208892809 CTGGGGGTGGGGAAGAGACAGGG - Intergenic
922690244 1:227683315-227683337 CTCTGGTTGAGGAAATGCCAGGG - Intergenic
923034097 1:230272092-230272114 CTGTGGCTCAGGAAATGACAAGG + Intronic
923252372 1:232189490-232189512 CTGTGGGTGATGGTGTGTCAAGG + Intergenic
923360156 1:233203262-233203284 CTGTGGGTGAGAAAGCCAAAAGG - Intronic
1063957594 10:11281102-11281124 CTGGGGGTGGGGCAGTGACTTGG - Intronic
1064391660 10:14947399-14947421 CTGTGGATCAGGGATTGACAGGG - Intronic
1064777117 10:18791124-18791146 ATGTGGGAGAGGGAGGGACAAGG + Intergenic
1067175588 10:43943480-43943502 GTGTGGGTGGGGAAGTGAGGTGG + Intergenic
1067717133 10:48698350-48698372 TTGTGGCTGTGGCAGTGACAAGG + Intronic
1069127427 10:64653734-64653756 TTGTGGGGGAAGAAATGACAAGG - Intergenic
1070273071 10:74976665-74976687 CTGTGGCTGCAGAGGTGACATGG - Intronic
1070286654 10:75088228-75088250 GTGTGAGTGAGGAAGCGACAGGG - Intergenic
1070313340 10:75289237-75289259 CTGGGGGAGAGGAAGGGCCAGGG + Intergenic
1071100535 10:82031820-82031842 TTGTGGGGAAGGAAGTGGCAAGG - Intronic
1071288325 10:84169441-84169463 CTCTGGTTGATGAAGTGCCAGGG + Intergenic
1071841424 10:89475897-89475919 CTGTGGATTAGGAACTGAAAGGG - Intronic
1071945235 10:90636266-90636288 CTGGGGGTGAGGAGCTGAAAAGG + Intergenic
1072635518 10:97175492-97175514 CTGTTGGTGGGGATGTGAAACGG - Intronic
1073233828 10:101996158-101996180 CTGTGGGTGAAGGAGTGAAAAGG + Intronic
1074447895 10:113535251-113535273 CTGTTGGTGAGTGAGGGACAAGG - Intergenic
1074667178 10:115741422-115741444 ATGTGAGTGAGGCAGTGAGAAGG + Intronic
1076783542 10:132737608-132737630 CTGTGGCTGAGGAGCTGGCAGGG - Intronic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1078452228 11:11448999-11449021 CTGTTTGTGAGGAAGGGAAAGGG - Intronic
1078453953 11:11460671-11460693 GTGTGGGTCAGGAAGAAACAGGG - Intronic
1079031267 11:16988069-16988091 CTGTAGGTGAGGTAGTGAGTAGG - Intronic
1080569621 11:33544046-33544068 CTGTAGCTGAGGATGAGACACGG - Exonic
1080754976 11:35188566-35188588 CTGCAGGTGAGGATTTGACAAGG - Intronic
1081630795 11:44688332-44688354 ATGTGGGTGAGGAAGAGAGAGGG - Intergenic
1081673791 11:44956677-44956699 CTCTGGGAAAGGAAGTCACAGGG + Intergenic
1084009354 11:66338995-66339017 GTGAGGGTGAGCAAGGGACAGGG - Intronic
1084345186 11:68542241-68542263 CTGTAGGTGGGGATGTGATAGGG + Intronic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084763075 11:71286426-71286448 CTGTGGGTGGGGATGTAAAACGG - Intergenic
1084974368 11:72788472-72788494 ATGTGGGTGAGGCAGTGCCTTGG + Intronic
1085686528 11:78627646-78627668 CTATGGGTGAGGAAAAGAAAAGG - Intergenic
1085955957 11:81395319-81395341 ATATGGGTGGAGAAGTGACAAGG + Intergenic
1086363683 11:86086700-86086722 CTGAGCTTGAGGATGTGACAAGG - Intergenic
1087658464 11:100955971-100955993 CTGTGGATGAAGTAGTCACAAGG - Intronic
1088727948 11:112656168-112656190 CTGTGGGAGAGGAAAAGACCTGG - Intergenic
1089581903 11:119486696-119486718 CTGTGGCTGAGCAAGTCACATGG - Intergenic
1089589612 11:119531997-119532019 CTGTGGGTGTGCAATGGACAAGG - Intergenic
1089695912 11:120216190-120216212 CTGTGGGTGGGGGAGCAACATGG + Intronic
1090701411 11:129299096-129299118 CTGGGGCTGGGGATGTGACAGGG + Intergenic
1090999243 11:131894564-131894586 CTGTGGGTTAGGCAGTGTCACGG - Intronic
1091659535 12:2373054-2373076 CTGTGGCGGGAGAAGTGACAAGG + Intronic
1091754041 12:3040342-3040364 CTGTGGGAGAGAAAAAGACAAGG - Intronic
1092223986 12:6734528-6734550 CTGTGGGTAAGGAATCGGCACGG + Intergenic
1093484863 12:19641677-19641699 CTGTGGGGGAGGAAGGGAAATGG - Intronic
1095762760 12:45858423-45858445 CTGATGGTGAGAAAGTGGCATGG - Intronic
1095891075 12:47235563-47235585 CTGTGGGCGAGGAAGTCACCGGG + Exonic
1096783014 12:54001599-54001621 CTGGGTGTGAGGAAGTGTCTGGG + Intronic
1096801883 12:54115789-54115811 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1097231688 12:57516093-57516115 CTGTAAGTGAGGAAGCGGCAGGG - Intronic
1098107026 12:67079288-67079310 CTGTAGGTGAAGAAGTCCCAGGG + Intergenic
1099824778 12:87761198-87761220 CAATGGGTGAGGAAGTAGCATGG + Intergenic
1099924111 12:88996560-88996582 CTTTGAGGAAGGAAGTGACATGG + Intergenic
1101575712 12:105994471-105994493 CTGGGGCTGAGGAAGTTCCAAGG - Intergenic
1101903692 12:108810072-108810094 CTGTGGGACAGGAGGTGGCAGGG - Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102151514 12:110691583-110691605 CTCTGGTTGAGGAAGGGAAAAGG + Intronic
1102627125 12:114244085-114244107 CTCTTGGTGGGGAAGTGACAAGG + Intergenic
1102759269 12:115371367-115371389 CTGTGGCTAAGGAAGTTTCATGG + Intergenic
1104339309 12:127932405-127932427 CTGTTGGTGGGGAATTGAAAAGG - Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104798743 12:131538550-131538572 CTGTCTGGGAGGCAGTGACATGG + Intergenic
1108757552 13:53522250-53522272 CTGTGGTTGTGAAAGTGAAAGGG + Intergenic
1110366112 13:74687733-74687755 CTGTGAGTTAGGAAATGAAAGGG - Intergenic
1110792194 13:79598840-79598862 CTGTGGTTGAAGAAATGACCAGG - Intergenic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115475073 14:33805714-33805736 CTGGGGCTGAGGAGGTGGCAGGG - Intergenic
1116601764 14:46934858-46934880 CAGTGGGTGAGGAAAGCACAAGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117303213 14:54448479-54448501 CTGTGGGTTAGGAAGCACCATGG - Intergenic
1118228843 14:63928980-63929002 CTGTGGTTCAGGAAATTACAAGG - Intronic
1118820917 14:69345342-69345364 GTGTGGGAGAGGAATTGAAAGGG + Intronic
1121657602 14:95609001-95609023 CTGTTGGTGGGGATGTGAAATGG - Intergenic
1123162797 14:106295812-106295834 CTGTGGCTGAGGAGATTACAGGG - Intergenic
1123648901 15:22463325-22463347 CAGTGGATGTGGAAGGGACAGGG - Intronic
1123677059 15:22720801-22720823 CAGTGGAGGAGGAAGAGACAAGG + Intergenic
1123729435 15:23132360-23132382 CAGTGGATGTGGAAGGGACAGGG + Intronic
1123747603 15:23329842-23329864 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1124279965 15:28353693-28353715 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1124302734 15:28557918-28557940 CAGTGGATGTGGAAGGGACAGGG - Intergenic
1124383605 15:29188179-29188201 CTGTCACTCAGGAAGTGACAAGG - Intronic
1125205284 15:37147455-37147477 CTGTGGGTGGAGAAGTAAAAAGG - Intergenic
1125249478 15:37683106-37683128 CTGTCTTTGAGGAGGTGACATGG + Intergenic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1128217413 15:65944142-65944164 CTGGGGGTTAGGAGGTGGCAGGG + Intronic
1128622053 15:69159495-69159517 CTGTGGGTGAGGGAGTGAAGAGG + Intergenic
1129046817 15:72742809-72742831 CTGTGTGTGTGTAAGAGACAAGG - Intergenic
1129205975 15:74037197-74037219 CTGAGGGTGAGGCTGGGACAAGG - Intronic
1129321948 15:74780337-74780359 CTGGGGGTGAGGGAGTGGAAAGG - Intergenic
1129462270 15:75705304-75705326 CTGTGTGGGACTAAGTGACATGG - Intronic
1129480108 15:75817305-75817327 CTGTGGAGGGGGAAGTGATAGGG - Intergenic
1129851641 15:78797137-78797159 CAGGGTGGGAGGAAGTGACACGG - Intronic
1130226330 15:82060981-82061003 CTGTGTATGAGGAAGTGAAAGGG - Intergenic
1130251349 15:82301956-82301978 CAGGGTGGGAGGAAGTGACACGG + Intergenic
1130317072 15:82805369-82805391 CTGTGGCTCAGGAATTGCCAAGG - Intronic
1131078038 15:89510685-89510707 TTGGGGGTGAGGAAGGGAGAGGG + Intergenic
1132557240 16:578071-578093 CTGTGGCCGAGGTAGTGAGAGGG + Intronic
1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738157 16:1397557-1397579 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738186 16:1397644-1397666 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738215 16:1397731-1397753 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738244 16:1397818-1397840 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1133278936 16:4654282-4654304 CTGTTGCTGAGGAAATGACAAGG + Intronic
1133348168 16:5084028-5084050 CTGCGGTTGAGGAAGTGATCAGG + Intronic
1133879925 16:9772061-9772083 TTGTGGGTGAGGAACTGGAAAGG - Intronic
1134432930 16:14228172-14228194 CTGTTGGTGGGAAAGTGAAATGG + Intronic
1134746834 16:16595094-16595116 CATGGGGTGAGGAAGTGGCAGGG + Intergenic
1134998640 16:18758569-18758591 CATGGGGTGAGGAAGTGGCAGGG - Intergenic
1136019734 16:27432431-27432453 CTGTGGCTGGGGTACTGACAGGG + Intronic
1136284514 16:29233265-29233287 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1136576620 16:31129017-31129039 TGGTCAGTGAGGAAGTGACAAGG - Intronic
1137054639 16:35738275-35738297 CTGTGGCTAAGGAATTGACCTGG + Intergenic
1137539911 16:49355206-49355228 CGCTGGGCGAGGAAGTGACAAGG + Intergenic
1137624833 16:49901003-49901025 GTGTGGGAGAGGAAGAGAGAGGG - Intergenic
1137671838 16:50283795-50283817 GTGTGGGTGAGGGAGTGACAGGG + Intronic
1138190387 16:55009446-55009468 CTGGGGGTGTGGCAGTCACAGGG + Intergenic
1139545724 16:67648664-67648686 CTCTGGGAGAGGACGTTACACGG - Exonic
1140588110 16:76319021-76319043 CTGTGGGATAAGAAGTGTCAAGG + Intronic
1140872972 16:79123650-79123672 CTGTGGGTGAGAAAGAAATAGGG - Intronic
1141886782 16:86897687-86897709 CTGTGGCTGTGGCAGTGACCTGG - Intergenic
1142089549 16:88202778-88202800 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1142894281 17:2964183-2964205 CTGTGGGAGAGGAGCTGCCAGGG + Intronic
1143084537 17:4405918-4405940 CAGTGGTTCAGGAAGGGACACGG - Intergenic
1143280658 17:5751946-5751968 CAGTGGGAGAGGCAGGGACAAGG + Intergenic
1143685773 17:8514516-8514538 GTGGGGCTGAGGAGGTGACAGGG - Intronic
1144713248 17:17416941-17416963 GTGAAGGTGAGGCAGTGACAAGG - Intergenic
1145004924 17:19332396-19332418 CTGGGGGTGAGGAAGAGCCAGGG + Intronic
1147599683 17:41738197-41738219 CTGTAGGTGAGGAAGCCACGTGG - Intergenic
1147651343 17:42063699-42063721 CTGAGGGAGAGGCAGTGGCAAGG + Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148965020 17:51427859-51427881 CAGTGGGAGAGGGAGTGAGAGGG + Intergenic
1149414371 17:56443517-56443539 CTGCGGGTGAGGAAGGGAAGAGG - Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150060874 17:62067059-62067081 CCGTGGCTGAAGAAGTGACATGG - Intergenic
1150294771 17:64001870-64001892 CTGAGGTTGAGGGAGTGAGAAGG - Exonic
1150964996 17:69958225-69958247 CTGTGGGTGAGAAAGAAACATGG + Intergenic
1152344720 17:79743997-79744019 CTGGGTGTTAGGAAGAGACAGGG + Intergenic
1153168001 18:2283898-2283920 CTTTGGGCGAGGAAGGGAGAAGG - Intergenic
1153763743 18:8355546-8355568 ATTTGGGTGTGGAAGTGACAAGG + Intronic
1153833681 18:8945255-8945277 CTGAGGGAGAGGAAGGGACCAGG + Intergenic
1153927162 18:9844177-9844199 CTGAAGGACAGGAAGTGACAGGG - Intronic
1153969776 18:10215656-10215678 CTCTGGGAGAGGAAGTGGCCTGG - Intergenic
1154029992 18:10745216-10745238 CTATGGGTGGGGAAGGGACCTGG - Intronic
1154430453 18:14304204-14304226 GTGTGGGTGAGGATGAAACATGG + Intergenic
1156744341 18:40370860-40370882 CTGTGTGTGAGTGAGTGAGAGGG - Intergenic
1157300320 18:46474388-46474410 CTGTGGGTAAGAAAGTGCCCCGG + Intergenic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1157570969 18:48711951-48711973 CTGGGGGTCAGGCAGTGACCAGG + Intronic
1157644734 18:49256118-49256140 CAATGGGTGGGGAAGAGACAAGG + Intronic
1160381825 18:78463512-78463534 ATGTTGGTGAGGAGGTGAAATGG - Intergenic
1160590102 18:79939320-79939342 CTGAGGGTGAGGACATGCCAAGG - Intronic
1160912924 19:1483133-1483155 GTGTGGGTGAGGGTGTGACTCGG + Intronic
1161238823 19:3210730-3210752 GTGAGGGTGGGGAAGGGACAGGG + Intergenic
1161725783 19:5927771-5927793 CTGCTGGTGGGGAAGTGCCAGGG + Intronic
1161734633 19:5983950-5983972 CTGTGGGTGAGGAATGGGAAGGG - Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1163216795 19:15885138-15885160 CTTTGGGGGAGGAAGAGAGAGGG - Intronic
1163446780 19:17351658-17351680 CTGGGGGTGAGGAAGTGGCTGGG + Exonic
1163640758 19:18460807-18460829 CTGTGGTGGAGGAAGAGACATGG - Intronic
1163732168 19:18955460-18955482 CTGGGTGAGAGGAAGGGACAGGG - Intergenic
1165799958 19:38543430-38543452 CTGCAGGTGAGGACGTGAGACGG + Exonic
1165879501 19:39032254-39032276 CTGCGGGAGAGGAAGGGTCAAGG + Intronic
1202700930 1_KI270712v1_random:163232-163254 GGGTGGGTGAGGAAGTGAGCAGG + Intergenic
925421440 2:3716047-3716069 CTGTTGTTCAGGGAGTGACATGG + Intronic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
927784746 2:25965910-25965932 CTGTGGGGGTGGAAAAGACAGGG + Intronic
928265271 2:29805990-29806012 ATGTGAGTGAGGAGGTGAAATGG + Intronic
929054999 2:37869046-37869068 CAGAGGGAGAGGAAGAGACATGG - Intergenic
929070465 2:38024378-38024400 CTGTTGGTGAGAATGTGAAATGG - Intronic
929417646 2:41760074-41760096 GTGTGGGTGAGGCAGAAACAAGG - Intergenic
929933655 2:46277585-46277607 CTGTGGGTGAGGGACTGGCGGGG + Intergenic
932662966 2:73672937-73672959 CTGTGGGAGCGGAACTGGCAGGG + Intergenic
932734059 2:74242053-74242075 CTGTGGATGAGCACATGACACGG + Intronic
933025520 2:77252777-77252799 ATTTGGGGGAGGAAATGACATGG + Intronic
933215607 2:79626370-79626392 CACTGGGTGGGGAAGTGAGAGGG + Intronic
933389333 2:81651155-81651177 CTGTGGTTGATGAAATGCCACGG + Intergenic
933464320 2:82632812-82632834 CTTTTGGTGAGGATGTAACATGG - Intergenic
933720389 2:85393988-85394010 CTGGGGGTGAGGATGAGTCAGGG + Intergenic
933733710 2:85478341-85478363 CTGTGGGTGAGGAACTTGAACGG + Intergenic
933798972 2:85944593-85944615 CTGTGGGTGAGGAACTTGAATGG - Intergenic
934171858 2:89546721-89546743 GGGTGGGTGAGGAAGTGAGCAGG + Intergenic
934282166 2:91621039-91621061 GGGTGGGTGAGGAAGTGAGCAGG + Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
935005953 2:99077294-99077316 CTGAGGGTGAGGCAGGGGCATGG - Intronic
936637280 2:114273219-114273241 TTGTGGGAGATGAAGTGAGAAGG - Intergenic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937527966 2:122794324-122794346 CTGAGGGTGTGGGAGTGGCAGGG + Intergenic
938734186 2:134171545-134171567 CTCTGGGTGTCGAAGTGATAGGG + Intronic
939183273 2:138828654-138828676 TTGTGGATGAGGAAGTTACGAGG - Intergenic
940105088 2:150090399-150090421 CTGTGGTTGTGGGAGTGAAAAGG - Intergenic
940890547 2:159031305-159031327 CTGTGGGGAAGGAAGGGCCATGG + Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941070114 2:160945979-160946001 CTGTGGGTTTGGAAGAGACATGG + Intergenic
945307851 2:208276051-208276073 GTGGGGTTGGGGAAGTGACAGGG + Intronic
946122271 2:217526496-217526518 CTCTGGGTGGGGCAGTGGCAGGG + Intronic
946307085 2:218862126-218862148 GAGTGGGGGAGGAGGTGACACGG + Intronic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947691279 2:232138730-232138752 CTGTGGGTGCGAAAGTGTTATGG + Intronic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
947815184 2:233032079-233032101 CAGTGGGAAAGGAAGAGACAGGG - Intergenic
948238478 2:236408571-236408593 ATGTGGGTGTGGCAGTGACATGG + Intronic
948625882 2:239267597-239267619 CTCCTGGTGAGGAAGTGTCACGG - Intronic
948786458 2:240355403-240355425 CTGAGGTTGAGGAAGGGACAGGG - Intergenic
948964404 2:241365919-241365941 CTATGAGGGAGGAAGTGAAAGGG - Intronic
949017075 2:241719577-241719599 CACTGGGTGAGGAAGAGACCAGG - Intronic
1169226031 20:3857571-3857593 TTCTGGGTGGGGAAGTGGCAGGG + Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171422249 20:25025051-25025073 CTATGGGCGAGGAAGGGAGATGG + Intronic
1171794828 20:29558677-29558699 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1171853628 20:30325588-30325610 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1172102713 20:32495179-32495201 CTGTGGCTGAGGAAGTGCCCAGG - Intronic
1172122743 20:32608287-32608309 CTGCAGGGGAGGAAGAGACAGGG - Intronic
1172177971 20:32984153-32984175 CTGTGGGTAAGGAAATGTCCTGG + Intronic
1172361966 20:34319091-34319113 CTGTTGATGGGGGAGTGACAAGG + Intergenic
1172863612 20:38077518-38077540 CTGAGGGAGAGGCTGTGACAAGG - Intronic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1173705178 20:45104961-45104983 TGGTGGAGGAGGAAGTGACAAGG - Intergenic
1173905334 20:46624151-46624173 CTGTGAATGAGGAATTGGCAAGG - Intronic
1174096558 20:48094127-48094149 CTGTTGGTGAGGATGTAAAAAGG + Intergenic
1174116907 20:48232479-48232501 CTTTTAGTGAGGAGGTGACATGG - Intergenic
1174239661 20:49123230-49123252 CTGTGGCTGAGGAACAAACAAGG + Exonic
1174741656 20:53020220-53020242 CCGATGGTGACGAAGTGACATGG - Intronic
1175010514 20:55729830-55729852 TTGTGGGTGAGGAGGAGACAAGG + Intergenic
1175337959 20:58208553-58208575 TTCTGGGTGAGTAAGTGAGAGGG - Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1178257181 21:31064825-31064847 CTGTGGGTCAGGAATTCACAAGG - Intergenic
1179019381 21:37624665-37624687 ATGTGGGTGTGGCAGTTACAGGG - Exonic
1179798423 21:43799051-43799073 CTGTGGGGCAGCATGTGACAAGG - Intronic
1180070356 21:45432757-45432779 CTGTGGGTCAGGGTGGGACATGG + Intronic
1181477409 22:23177316-23177338 GTATGGGGGAGGAAGTGATAAGG - Intergenic
1182005300 22:26954760-26954782 CTGTGTGTTAGGAAGTGACGGGG + Intergenic
1183404972 22:37625944-37625966 CTCTGGGTGAGGAAGGGGCCAGG + Exonic
1183814785 22:40290654-40290676 CGGGGGGTGGGGGAGTGACAGGG - Intronic
1184825302 22:46946545-46946567 CTGTGGATGAGGCAGTGAGGCGG - Intronic
1185060802 22:48605816-48605838 CTGTGGGTGGGGACTTGGCATGG - Intronic
949854735 3:8451113-8451135 CTGTGGGAGGGGAAGAGAAATGG - Intergenic
949875371 3:8623149-8623171 CTGGGGGTTGGGAAGTGCCAGGG + Intronic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
953004857 3:38968954-38968976 CTGTGTGTGGGGTAGGGACATGG - Intergenic
953116069 3:39993616-39993638 CTGAGAGTGAGGAGGTGACAAGG - Intronic
954332448 3:49898198-49898220 CTGTGGGGGTGGAACTGAAATGG + Exonic
954374269 3:50185848-50185870 CTATGGGACAGGAACTGACAAGG + Intronic
954892236 3:53941396-53941418 CTGGGAGGGAGGAAGTGAGATGG + Intergenic
954899771 3:54008818-54008840 CTGTGGGTAGGGAAGTAGCAGGG - Intergenic
955002088 3:54937008-54937030 CTGTGTGTGAGGAGGTGCTAAGG + Intronic
955837151 3:63068628-63068650 CTGGGGATGGGGAAGTGAAAGGG + Intergenic
956173014 3:66447559-66447581 CTGTGGGAGAGCAAATGACAAGG + Intronic
956510439 3:69988013-69988035 TTGTGGGTCAGGAAGTGAACAGG + Intergenic
958130094 3:89407685-89407707 TTCTGGGTGAGAAAGTGTCAAGG - Intronic
960041967 3:113159177-113159199 CTGTGTATAAGGAATTGACAAGG - Intergenic
961107198 3:124252081-124252103 TTGAGGGTGAGGAACTGACAAGG + Intronic
961557401 3:127705988-127706010 CTGTTGGTGAGAATGTGAAATGG + Intronic
962903111 3:139777788-139777810 GTGTGTGTGAGGCAATGACAAGG - Intergenic
964158859 3:153621519-153621541 CTGTGTGTGTGGAAGAGAAAGGG + Intergenic
964645139 3:158950937-158950959 CTGTGGGTTGGGAAGGGTCAGGG - Intergenic
964858210 3:161170547-161170569 CTGTGTGTGATGGGGTGACACGG + Intronic
965557639 3:170034432-170034454 CTGTGGGTGAGTGAATGAAAAGG + Intergenic
968527034 4:1065231-1065253 CTGTTGGTGAGAATGTGAAATGG - Intronic
968756162 4:2417593-2417615 ACGTGGGTGGGGAAGGGACAAGG + Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
970510251 4:16774769-16774791 GTGTGTGTGAGCAAGAGACAGGG + Intronic
971115034 4:23635815-23635837 CTGTTGGTGGGGAAGTAAAATGG + Intergenic
971374223 4:26043483-26043505 GTGTGGGTGAGAGACTGACAAGG - Intergenic
981017461 4:139988841-139988863 CACTGGCTGAGGAAGTGAGAAGG + Intronic
983387193 4:167080261-167080283 TAGTGGCTGAGGAAGTGAGAAGG + Intronic
983890645 4:173026199-173026221 CAGGGAGTGAGGAAGTGAAATGG + Intronic
985375241 4:189329663-189329685 CTGTGGGTGAGAAAAAGAGAAGG + Intergenic
985868633 5:2536438-2536460 CTGTGGGTGAGGAGAGGCCAGGG - Intergenic
988434602 5:31159238-31159260 CTGGGGGTGAGGGAGGGATATGG - Intergenic
991121202 5:63016180-63016202 GTGTGGGTGAGGGCCTGACAAGG + Intergenic
991994650 5:72375326-72375348 CTGGGGGTGAGGAACAGAGAAGG - Intergenic
992553139 5:77878059-77878081 GTGTGGCTGAGGACATGACAGGG + Intergenic
994211734 5:97094789-97094811 CACTGGGTGAGGAAGTGTCAGGG + Exonic
997304765 5:132829313-132829335 CTGGGGCTGAGGAATTGTCAAGG + Intronic
997372375 5:133370238-133370260 TTGTCGCTGAGGAAATGACAAGG + Intronic
997952446 5:138253103-138253125 CTGAGGCTGAGGTAGTGAAAGGG - Intronic
998193787 5:140048665-140048687 CTGTGCGTGAGGAAGTGCTTTGG - Intergenic
999171841 5:149602011-149602033 TTTTGAGTGGGGAAGTGACACGG + Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999309282 5:150541427-150541449 CTGGGGGTGGGGATGTGACAAGG + Intronic
999443800 5:151622783-151622805 CTGTGGTTGAGCAAGTCCCATGG + Intergenic
1000041224 5:157486549-157486571 CCGTAGGTCAGGAAGTGTCAGGG - Intronic
1000348531 5:160334186-160334208 CGGTGGGCGAGGCAGTGAAAAGG - Intronic
1000862706 5:166475847-166475869 CAGTGCCTGAGAAAGTGACAGGG - Intergenic
1001401254 5:171447856-171447878 TTGTGGGTGAGGGAGGGGCAGGG + Intronic
1002050115 5:176565769-176565791 CTGTGGGTCAGGACCTGACATGG - Intronic
1002430808 5:179202878-179202900 CTGTGTGAAAGGAAGTGACCTGG - Intronic
1002583033 5:180222011-180222033 CTGAAGAGGAGGAAGTGACATGG + Intergenic
1004140340 6:13012368-13012390 TTGTGGAAGAGGCAGTGACAGGG + Intronic
1006579643 6:35069319-35069341 CTGTGGATGGGGCAGGGACAAGG - Intronic
1008388678 6:50923352-50923374 ATGTATGTGAGGAAATGACAGGG - Intergenic
1011718880 6:90134817-90134839 CTGTGGGAGAGGGTCTGACAGGG + Intronic
1012198286 6:96372707-96372729 CTGTGGTTCAGGAAGTGAACAGG + Intergenic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1013189635 6:107791203-107791225 CTGGAGGTTAGCAAGTGACAGGG + Intronic
1013212040 6:107995768-107995790 TTGTGAGTGATGAAGTGACTTGG + Intergenic
1013917837 6:115363587-115363609 CTATGGGAAAGGAAGTGAGATGG - Intergenic
1014422862 6:121266905-121266927 CTGTCGGTGGGGAAGGGGCAAGG + Intronic
1015127735 6:129773026-129773048 CTGTGGGATAGCAAATGACATGG - Intergenic
1015467846 6:133567631-133567653 CTCTGGGTGTGGCAGTGTCATGG - Intergenic
1022387161 7:29912319-29912341 CTGTTGGTGAGAATGTGAAATGG + Intronic
1022547736 7:31204370-31204392 CTTTGGGTGAGGCAGTTTCAGGG + Intergenic
1022585366 7:31603720-31603742 CTGTGGGAGAGGAAGTAAGGTGG - Intronic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1024314112 7:47998169-47998191 CTGTGGGTGAGAATGTAACATGG - Intronic
1024616936 7:51123820-51123842 ATGTGGGTGAGGAGGTGGCATGG - Intronic
1026214912 7:68339959-68339981 CTTTGGGAGAGGGAGTGAGAAGG - Intergenic
1026312778 7:69202148-69202170 CTGTGGATGAGAGAGGGACAGGG - Intergenic
1026541027 7:71280159-71280181 CTGAGGTTGTGGAAGAGACAGGG + Intronic
1027830381 7:83169564-83169586 CTGTTGATGAGTAAGTGCCAAGG + Intergenic
1028093564 7:86732991-86733013 CTGTGGGGGAAGAAGTGATGGGG + Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1030345754 7:108431279-108431301 CTGTGGCAGTGGAAGTGGCACGG - Intronic
1030556202 7:111027017-111027039 CAGTGGGAGAGAATGTGACAAGG - Intronic
1031083379 7:117279325-117279347 CTGTGGGGGAGGAAGTAGAAAGG - Intronic
1031895443 7:127342390-127342412 CTCTGGGTAATGAAGTTACAGGG + Intergenic
1034545817 7:151788198-151788220 CTGTGGGTGGGAAAGTAAAATGG - Intronic
1034676998 7:152899028-152899050 CTGTGGTTGAGGAATCTACAGGG - Intergenic
1035837375 8:2769258-2769280 ATGTGGGTCAGAAAATGACAAGG + Intergenic
1036005104 8:4653101-4653123 CTGTGGCTGGGAAAGAGACAAGG - Intronic
1037087878 8:14875463-14875485 CTTTGGATAAGGAAGGGACAAGG + Intronic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1037678277 8:21071266-21071288 CTGTGGGTGGGAAGGTGACTTGG + Intergenic
1038083547 8:24167884-24167906 CTGTGGGTAATGAAATGGCAGGG - Intergenic
1040508954 8:48076601-48076623 CTGCTGGTGAGGATGTGAAATGG - Intergenic
1042975333 8:74462850-74462872 ATTTGAGTGATGAAGTGACAAGG + Intronic
1044696596 8:94929151-94929173 CTGTGGCAGAGAAAGTGCCACGG + Exonic
1044832383 8:96262307-96262329 CTCTGGGTGAGGAAGTGGGCTGG + Intronic
1046944600 8:119962889-119962911 CAGGGGGTGAGGAAGAGAGAGGG + Intronic
1048297521 8:133225393-133225415 CTGTGGGTGAGGTGGAGGCATGG + Exonic
1048356668 8:133659506-133659528 ATGTGGATGAGGAAGAGGCATGG + Intergenic
1048425475 8:134319372-134319394 CTGAGGGTGAGGAATTGAGATGG - Intergenic
1048568636 8:135630842-135630864 CTGTGGGTGAGTGAGTGAGTGGG + Intronic
1049113406 8:140664595-140664617 CAGTGGATGAGGAAGGCACATGG - Intronic
1050219803 9:3374217-3374239 CTGTTGGTGGGGATGTGAAATGG + Intronic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1053791432 9:41688885-41688907 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1054657760 9:67680242-67680264 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1056112581 9:83410295-83410317 CTGTGGGGGAGGGAGGGACAAGG - Intronic
1057088351 9:92232422-92232444 CTGTATGTGAGGAAAAGACATGG + Intronic
1057313992 9:93957655-93957677 CAGGGGGTGAGGAAGGGGCAGGG - Intergenic
1057700540 9:97360568-97360590 CCGAGGGTAGGGAAGTGACATGG - Intronic
1057988437 9:99741898-99741920 CTGTGGATGATGAAGAGCCATGG + Intergenic
1058104477 9:100955069-100955091 CTGATGGTGAGGATGAGACATGG + Intergenic
1058205207 9:102097119-102097141 CTGTGGGTGAAGAAATTTCAAGG + Intergenic
1058688320 9:107498085-107498107 CTGTGGGAGAAGAAATGACAGGG + Intergenic
1058748759 9:108018055-108018077 GTGTGGCTGAGGAACTGAAAGGG - Intergenic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1061042258 9:128146958-128146980 TTGGGGGTGAGGCAGTGTCATGG - Intergenic
1061120800 9:128641143-128641165 CTGTGGCTGAGGTAGGGACACGG - Intronic
1061219583 9:129242509-129242531 CTGTAGCCAAGGAAGTGACAGGG + Intergenic
1061410408 9:130418012-130418034 CTGAGGGTCAGGGAGTGACTTGG + Intronic
1061504123 9:131021353-131021375 CTGTGGGTGGGAATGTGAAATGG - Intronic
1061962733 9:133996621-133996643 ATGTGGGTGGGGAGGTGACGAGG + Intergenic
1185667325 X:1776218-1776240 CTGGGTGTCAGGGAGTGACATGG + Intergenic
1186410831 X:9342997-9343019 CTGGGGGTGAGGAAGTGCCTGGG + Intergenic
1186906006 X:14111211-14111233 ATGAGGCTGAGGAGGTGACAAGG - Intergenic
1188010394 X:25049146-25049168 CTGGGGGTGAGGAGTGGACAAGG + Intergenic
1188442790 X:30229786-30229808 CACAGGGTGAGTAAGTGACAGGG + Intergenic
1189256561 X:39644530-39644552 CTGTGGGGGAGGCTGAGACATGG + Intergenic
1189833724 X:45000421-45000443 CTCTGGTTGATGAAGTGCCAGGG + Intronic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1194239293 X:91423868-91423890 CTGTGGATGAGGGATGGACAAGG + Intergenic
1194779618 X:98009145-98009167 CTCTGGAGGATGAAGTGACAAGG - Intergenic
1195939966 X:110159874-110159896 CTTAGGGTGAGGAGGTGAAAGGG + Intronic
1198018489 X:132635378-132635400 CTGGGGGTGTGGAAGTGGCATGG - Intronic
1198713789 X:139534463-139534485 CTGTGGCTGTGGAACTCACAAGG - Intronic
1201308999 Y:12577496-12577518 CTCTGGTTGAGGAAATGCCATGG - Intergenic
1202095931 Y:21248216-21248238 ATGTGTTTAAGGAAGTGACAGGG - Intergenic