ID: 1059467539

View in Genome Browser
Species Human (GRCh38)
Location 9:114478565-114478587
Sequence CCCTCCTTGCAGGAGGTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 230}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059467529_1059467539 2 Left 1059467529 9:114478540-114478562 CCACCCCACTCACCTTTTTCTCA 0: 1
1: 0
2: 3
3: 57
4: 560
Right 1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1059467532_1059467539 -3 Left 1059467532 9:114478545-114478567 CCACTCACCTTTTTCTCATCCCC 0: 1
1: 0
2: 3
3: 66
4: 611
Right 1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1059467528_1059467539 3 Left 1059467528 9:114478539-114478561 CCCACCCCACTCACCTTTTTCTC 0: 1
1: 0
2: 10
3: 68
4: 613
Right 1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1059467526_1059467539 9 Left 1059467526 9:114478533-114478555 CCTTTCCCCACCCCACTCACCTT 0: 1
1: 1
2: 13
3: 158
4: 1228
Right 1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1059467530_1059467539 -1 Left 1059467530 9:114478543-114478565 CCCCACTCACCTTTTTCTCATCC 0: 1
1: 0
2: 2
3: 44
4: 533
Right 1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1059467531_1059467539 -2 Left 1059467531 9:114478544-114478566 CCCACTCACCTTTTTCTCATCCC 0: 1
1: 0
2: 1
3: 36
4: 453
Right 1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1059467527_1059467539 4 Left 1059467527 9:114478538-114478560 CCCCACCCCACTCACCTTTTTCT 0: 1
1: 0
2: 13
3: 109
4: 995
Right 1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1059467533_1059467539 -10 Left 1059467533 9:114478552-114478574 CCTTTTTCTCATCCCCTCCTTGC 0: 1
1: 1
2: 5
3: 65
4: 779
Right 1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1059467525_1059467539 12 Left 1059467525 9:114478530-114478552 CCTCCTTTCCCCACCCCACTCAC 0: 1
1: 2
2: 12
3: 194
4: 1459
Right 1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059467539 Original CRISPR CCCTCCTTGCAGGAGGTGCA GGG Exonic
900115681 1:1026866-1026888 CCCAGCAGGCAGGAGGTGCAGGG - Intronic
900914700 1:5628328-5628350 ACCTCCTTTCAGGTGGTGCTAGG + Intergenic
901497505 1:9630300-9630322 CCCTCCTTGAAGGGTGTGAAGGG + Intergenic
901689641 1:10964370-10964392 CCCACCTTCTAGGAGGTTCATGG - Intronic
902735125 1:18395507-18395529 CACTCCTGGCAGAAGGTGAAGGG - Intergenic
903280909 1:22249306-22249328 CCCTGCCTGCAGGAGGTGCTGGG - Intergenic
904265611 1:29317037-29317059 CACTTCTCACAGGAGGTGCAGGG + Intronic
904864609 1:33568505-33568527 CCCTCCATGCAGCAGATGCTCGG - Intronic
906545558 1:46617035-46617057 GCCTCCTTGGTGGAGGTCCAAGG - Intergenic
909707781 1:78607867-78607889 TGCTTCTTGCAGGAAGTGCAAGG + Intergenic
910144980 1:84069123-84069145 CCATTCTTGCAGGAGGGGTAAGG + Intergenic
912487672 1:110041868-110041890 ACCTCCTTGGAGGAGGAGAACGG + Intronic
912557070 1:110524176-110524198 CCCTGCCTGCAGGAAGTGCCTGG - Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
915648190 1:157288759-157288781 CCCTCCCTCCAGGAGCTGCTGGG - Intergenic
917723737 1:177810982-177811004 CTCTCCTGGCAGAAGGTGAAGGG + Intergenic
917817364 1:178724971-178724993 CCCTCCTTTCAGCAGGCGCCGGG + Intergenic
918067087 1:181108808-181108830 CCCTCCTGTCAGGATGTGCCAGG + Intergenic
919486918 1:198157309-198157331 CCCTCCCGGCAGGAGCTGCCCGG - Intronic
921784733 1:219216613-219216635 TCTTCCTTTCAGGAGGTTCATGG + Intergenic
923314940 1:232771237-232771259 TCCTCTTTGCTGGGGGTGCAGGG - Intergenic
924194481 1:241591227-241591249 CCCTCCTTGAAGGATTTGCCTGG - Intronic
1063813318 10:9740258-9740280 CCCACCTTGCATGAGGTTCCAGG - Intergenic
1067141674 10:43663065-43663087 CCCTCATGGCAGAAGGTGAAGGG + Intergenic
1069840524 10:71336765-71336787 TCCTCCTTGCAGTGTGTGCAAGG - Intronic
1070164364 10:73886832-73886854 CCCTCCTTTCAGGAGGTATAAGG + Intergenic
1071150077 10:82623629-82623651 CCTGCCTTGCAAGAGGTGCTAGG - Intronic
1073475204 10:103748046-103748068 CCATCCTTGCAGGAGATGGGTGG - Intronic
1073571240 10:104582747-104582769 CCATCCTCACAGCAGGTGCAGGG - Intergenic
1074359497 10:112813853-112813875 CTCTCCTCGCAGGAGATGAATGG - Intronic
1075608716 10:123834795-123834817 CCCTCCTTGGTGGGGGTGCAGGG + Intronic
1075648847 10:124114513-124114535 ACCTCCTTGAAGGAGGAGGAGGG + Intergenic
1076221092 10:128733749-128733771 CCCGCCCTGCAGCAGGTGCATGG - Intergenic
1076814043 10:132905890-132905912 CCTTCCTTGCAGGTGGGGCTGGG - Intronic
1080034834 11:27700306-27700328 CCCCCCGAGCAGGAGGTGGAGGG + Intronic
1083264268 11:61539016-61539038 TCCTCCTTGCTGGAGATCCAGGG + Intronic
1085503947 11:77045261-77045283 CACTCCTTACTGGAGGTGCTAGG + Intergenic
1090355230 11:126136058-126136080 GCACCCTTGCAGGGGGTGCAGGG - Intergenic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1092083931 12:5740259-5740281 CCCTCCTTTCAGGTGCTGCGTGG - Intronic
1094209909 12:27878106-27878128 CCTTCCTTGAAGGAGGAGCTGGG + Intergenic
1097257979 12:57694912-57694934 CCCTGCTTGCTGAAGGTGAAAGG + Exonic
1099732824 12:86526564-86526586 CCCTGCATGCAGGAGTGGCAAGG + Intronic
1101298935 12:103457770-103457792 CCCTCCTGGCAGGGGGTGGGGGG + Intronic
1102162437 12:110780653-110780675 CCATCCACACAGGAGGTGCAAGG - Intergenic
1102495915 12:113319565-113319587 CCCTCGTGGCAGCAGGGGCAGGG - Intronic
1102623233 12:114213674-114213696 CCCTGCTTGCAAGAGATGCTTGG + Intergenic
1104687131 12:130793752-130793774 CCCTCCCTGCAGGGTGTGCCAGG - Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105441933 13:20422514-20422536 CCAGCCTGGCTGGAGGTGCAAGG - Intronic
1106146372 13:27053304-27053326 CACTCCTTCCAGGAGCTGCCTGG - Intergenic
1106179506 13:27358655-27358677 CACTCCTAGCAAGAGGTGGAAGG - Intergenic
1109667708 13:65560149-65560171 CCATCATAGCAGGAGGTGAAAGG + Intergenic
1110607434 13:77448981-77449003 CTCTCGTGGCAGGAGGTGAAGGG - Intergenic
1112248351 13:97754821-97754843 CCCACCTGGCAGAAGGTGGAGGG + Intergenic
1113585015 13:111458967-111458989 CGCTCCTCCCAGGAGGGGCAAGG + Intergenic
1113662429 13:112116760-112116782 CCTTCCTTACAGGAGGGACAGGG - Intergenic
1115954440 14:38762437-38762459 CCTTTCTTGCAGATGGTGCATGG - Intergenic
1119530244 14:75354977-75354999 CACTCCCTGCAGGAGGAGCTGGG - Intergenic
1119539309 14:75428235-75428257 CCCACCGTGCAGAAGGTGCGGGG - Intronic
1119571964 14:75682544-75682566 CACTCCTTGCAGGAGGGGATGGG + Intronic
1119635071 14:76267056-76267078 CACTCCTTGTACCAGGTGCATGG + Intergenic
1121168298 14:91830871-91830893 ACCTCCTTGAAGGGAGTGCAAGG - Intronic
1122289782 14:100674352-100674374 CCTTCCGAGCAGGAGGCGCAAGG + Intergenic
1123216431 14:106813139-106813161 CCCTCCTTGCAGCCTGGGCAGGG - Intergenic
1123717067 15:23040703-23040725 CCCACCTGGCCGGAGGTGCTGGG + Intergenic
1123717294 15:23041453-23041475 CCCACCTGGCCGGAGGTGCTGGG + Intergenic
1123717856 15:23043342-23043364 CCCACCTGGCCGGAGGTGCTGGG + Intergenic
1123718538 15:23045710-23045732 CCCACCTGGCCGGAGGTGCTGGG + Intergenic
1123719046 15:23047485-23047507 CCCACCTGGCCGGAGGTGCTGGG + Intergenic
1123719337 15:23048490-23048512 CCCACCTGGCCGGAGGTGCTGGG + Intergenic
1123719823 15:23050184-23050206 CCCACCTGGCCGGAGGTGCCGGG + Intergenic
1124054032 15:26225087-26225109 CCTTCCTTGCATGAGGGACAGGG - Intergenic
1127267942 15:57376420-57376442 CCCTCCTGGGAGGAGGGGCAGGG - Intronic
1128778423 15:70341695-70341717 CCCTCCATGCAGCAGGGGCATGG - Intergenic
1129062056 15:72868034-72868056 CATTCCTTGCTGGAGGTTCAAGG + Intergenic
1129064412 15:72889233-72889255 CCCACCTTGAAGCAGGTGAAAGG - Intergenic
1129671631 15:77610947-77610969 CTCTCCTGGGAGGAGGGGCAGGG + Intergenic
1129671651 15:77611001-77611023 CTCTCCTGGGAGGAGGGGCAGGG + Intergenic
1129696469 15:77743160-77743182 CCCTCCTGGCAGGGGGAGCATGG - Intronic
1129832617 15:78680664-78680686 CCCGCTTTCCAGCAGGTGCAAGG - Intronic
1132299926 15:100769009-100769031 GCCTCCATGCAGGACTTGCATGG - Intergenic
1132335949 15:101048854-101048876 CCCCCCTTGCAGGACGGGAAAGG + Intronic
1132671323 16:1103253-1103275 CTCTCCTGGCAGGCGGTGGACGG + Intergenic
1132738694 16:1400002-1400024 CTCGCAGTGCAGGAGGTGCACGG + Intronic
1133025574 16:2987706-2987728 TCCTCCTTCCATGAGGGGCAGGG - Intergenic
1133770543 16:8865025-8865047 CCCTCCTTGCAGTAAGCACAGGG - Intronic
1133796222 16:9048578-9048600 CGCTCCCTGGAGGAGATGCAAGG + Intergenic
1134199910 16:12189520-12189542 GCATCCTGGCAGGTGGTGCATGG + Intronic
1136991777 16:35156692-35156714 CCATTCTTACAGGAGGTGCAAGG - Intergenic
1137458543 16:48637108-48637130 CCATGCTTCCAGGAGGTGGATGG + Intergenic
1137733787 16:50709549-50709571 CTCTCCCTGCATGGGGTGCATGG + Intronic
1139418337 16:66832175-66832197 CCCTCCTTTCAGGAAGAGAACGG + Intronic
1140696388 16:77538490-77538512 CCCTCCATACAGTAGGTGAAGGG - Intergenic
1140915165 16:79486899-79486921 TCCACCTTGTAGGAGGTGGAGGG - Intergenic
1141714210 16:85717493-85717515 CCAGCCTTGCAGGAAGTGCCAGG + Intronic
1141820505 16:86442303-86442325 CCCCCCTTCCTGGAGGAGCAAGG - Intergenic
1142717679 17:1755819-1755841 GCTTCCCTGCTGGAGGTGCAGGG + Intergenic
1146299783 17:31678901-31678923 TCCTCCTAGCAGCAGGTCCAGGG - Intergenic
1146512173 17:33459606-33459628 CCCTCCTTGCAGGAAGTAAGCGG + Intronic
1147129834 17:38400771-38400793 CCCTGCTTTCAGGAGGAGCGGGG + Exonic
1148791170 17:50173821-50173843 GCCTCCCCGCAGGAGGAGCATGG + Intronic
1148909155 17:50931226-50931248 CCGTCCGGGCAGGAGGTGCAGGG + Intergenic
1150209432 17:63434057-63434079 CCCTCCTGGCAGCAGATGCCTGG - Exonic
1150228745 17:63538398-63538420 CCCGCCTTGCAGGTGCTGAAGGG + Exonic
1150436319 17:65157076-65157098 CCCTCCTCGGAGGCGGTGCAGGG - Intronic
1152585647 17:81188353-81188375 CCCACCCGGCAGGGGGTGCAGGG - Intergenic
1153470397 18:5438100-5438122 CCATCCTTGCAGGTGGTGCTTGG - Exonic
1153511152 18:5854455-5854477 CCCTTCTTTCAGGAGGTGCAGGG - Intergenic
1154130935 18:11736545-11736567 CCCTGTTTGCAGAAGGTGCTTGG + Intronic
1157663316 18:49464743-49464765 CCCTCCTTGGAGGAGTGGCCAGG - Intergenic
1159085489 18:63784932-63784954 CCCACCAGGCATGAGGTGCAGGG - Intronic
1161561105 19:4972876-4972898 CCCTCATTGCAGGGCGTGCAGGG - Intronic
1162554533 19:11378534-11378556 TCCTCCGTGAAGGGGGTGCAGGG + Exonic
1164410951 19:28004435-28004457 CCTTGCTTGCAGGAGGTCTAAGG + Intergenic
1165466414 19:35977593-35977615 CCCTCCATGCAGGGGGCGCTAGG - Intergenic
926317227 2:11719443-11719465 CCCCCTTTGCAGGAAGTCCAGGG + Intronic
927937410 2:27083487-27083509 CTCTCCTTGCAGGGCCTGCAGGG - Exonic
930058206 2:47268183-47268205 CCCTCCTTCCAGGAGGGCCTGGG + Intergenic
930845074 2:55895114-55895136 CACTCCTTGCAGGATTGGCAGGG + Intronic
931564077 2:63595502-63595524 CCCACCTTTCAGGAGGGGAAGGG - Exonic
933339574 2:81004921-81004943 ACCTCCTGGCAGCAGCTGCATGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
937220744 2:120342002-120342024 CACACCTTGCAGGAGCTGCAGGG + Intergenic
938118522 2:128618239-128618261 CACTCCTGGCAGAAGGTGAAGGG - Intergenic
939131799 2:138244011-138244033 CCCAACTTCCAGGAGGTCCAGGG + Intergenic
941584249 2:167337026-167337048 CCCTCCATGGAAGAGGGGCAGGG - Intergenic
943226888 2:185188890-185188912 CCCTCCTGGCAGCAGGGGCATGG - Intergenic
943858486 2:192828840-192828862 GCCTCCTTGCAGGAGATGAGAGG + Intergenic
945041266 2:205745637-205745659 CCTTCCTAGCAGGACGTGCGGGG + Intronic
945212377 2:207397302-207397324 CCCTCCTTGCAGGACTAGCGAGG + Intergenic
946389768 2:219408488-219408510 CCCTCCTTGGAGAAGGAGCAAGG + Intergenic
946807858 2:223489685-223489707 TCTTCCTTTCTGGAGGTGCATGG + Intergenic
948121318 2:235532820-235532842 CCCTCCTGGCAGCCGGTGCATGG + Intronic
1168887069 20:1267090-1267112 TCCTTCTTGGAGGAGGAGCAGGG + Intronic
1171135626 20:22692148-22692170 CGCTGCTTGCAGGAGGGACAGGG - Intergenic
1173177999 20:40779243-40779265 CCCTCCTAGAATGTGGTGCATGG - Intergenic
1175415127 20:58795987-58796009 CCCTGCTGGCAGGGGGTGGAGGG + Intergenic
1175786229 20:61713319-61713341 CACTCCTTGCAGGAGGTCTGGGG - Intronic
1175800807 20:61800120-61800142 CCCTCCTTGAAGCCTGTGCAGGG + Intronic
1178237328 21:30857937-30857959 CCCTAATTTCAGGAGGTGCTTGG - Intergenic
1178244170 21:30935813-30935835 GCCTCCTTGCAGCTGGGGCAGGG - Intergenic
1178552149 21:33550396-33550418 ACCTCCATGCCGGAGTTGCAGGG + Exonic
1179479833 21:41670100-41670122 CTCTCCTTGAAGGATGTGTAGGG - Intergenic
1180149003 21:45938144-45938166 CCCTGTTTGCAGGAGGGGCAGGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183362925 22:37391989-37392011 TCCTCCTTGCAGCAGGTGCGTGG - Intronic
1184278063 22:43421548-43421570 GCCTCCTTGCTGGATATGCAAGG + Intronic
1184967486 22:47991371-47991393 TCCCCTTTGCAGCAGGTGCAAGG + Intergenic
1185014558 22:48335421-48335443 CCCTCCATGCAGGAGGCCCCAGG + Intergenic
1185137920 22:49083824-49083846 CCCTGGATGCAGGAGGTGCTGGG + Intergenic
1185242488 22:49754188-49754210 CCCACCTGGCAGCAGGTGCCTGG + Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
950131786 3:10552285-10552307 CTCACCTTGCAGGAGGAGAAGGG - Intronic
952746190 3:36783294-36783316 CCCTTCTTGGTGGAGGTACATGG + Intergenic
952923509 3:38305437-38305459 CCCTCCTTGCTGCTGTTGCAAGG + Intronic
953194929 3:40723287-40723309 CCCTCCCTGCAGATGGGGCAGGG - Intergenic
954396429 3:50295715-50295737 CCATCCTTACAGGAGGAGCTGGG + Intronic
954443359 3:50533823-50533845 CCCTCCCCCCAGGAGTTGCAGGG + Intergenic
954625562 3:52020216-52020238 CCCTCCTGGCAGGAGGTGACAGG - Intergenic
961604480 3:128083513-128083535 CCCTGCGGGCAGGAGCTGCAGGG + Intronic
962735051 3:138318246-138318268 CCCTGGATGCAGGGGGTGCAGGG + Intronic
963286079 3:143435910-143435932 CCCTCCCTGCAGGGGCTGCCTGG + Intronic
963870601 3:150410038-150410060 GCCTCCATGCAGGGGGCGCACGG + Exonic
968349852 3:198045353-198045375 CCGTCATGGCAGGAGGTGAAAGG + Intergenic
971691294 4:29840088-29840110 CCCTCATTGCTGGAGATGCTGGG - Intergenic
972136975 4:35904565-35904587 CTCTCCTTTCAGGAGGTATAGGG + Intergenic
976202765 4:82596223-82596245 CTCTCCTTCCAGGAGGAGCCAGG + Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979189180 4:117835293-117835315 CCCTCATCGCAGGACCTGCAAGG - Intergenic
980100630 4:128538535-128538557 TCCCCCTTGCAGGGCGTGCAAGG + Intergenic
982831210 4:160062978-160063000 GCCTCCTTTCTGGAGGTGCTAGG + Intergenic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
984929212 4:184831798-184831820 GCATCCTGGCAGGAGGTTCAAGG - Intergenic
985897215 5:2755920-2755942 CAGTCCTGGCAGGATGTGCAAGG + Intergenic
986690612 5:10310620-10310642 CACTCCTTGGTGGAGCTGCAGGG + Intergenic
988536305 5:32072305-32072327 CCCTGCTTACTGGAGGTGCTGGG - Exonic
988866281 5:35338787-35338809 CCCTCCTTGCACCAGGTTGAAGG + Intergenic
989533364 5:42534852-42534874 CCATCCTTGCAGGAGCAACATGG + Intronic
991007195 5:61840971-61840993 CCATGCTTGCAGGAGGTGAATGG - Intergenic
991184304 5:63789324-63789346 GCCACCTTGCAGGAGGTGCAAGG + Intergenic
991459600 5:66844001-66844023 CCCTCCTTGCATGAGGAGGCAGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
998459276 5:142297428-142297450 CCCTCCTTCCTGGAGTTACAAGG + Intergenic
998543122 5:143002134-143002156 CCCTTCTTCCAGGAGGTTCCGGG - Intronic
1002093607 5:176818240-176818262 CCCGGCCTGCAGGAGGTGCTCGG - Intronic
1003163514 6:3656230-3656252 GCCTCCTTGCAGGAGAAGCGTGG - Intergenic
1005909035 6:30292116-30292138 CGGTCCTTGCAGGAGTTGCCAGG + Intergenic
1006894196 6:37456182-37456204 CCCTCTTTGCAGTATGTGTAGGG + Intronic
1007277476 6:40685828-40685850 CCCTTCTTGATGGAGGTGAAAGG + Intergenic
1007644817 6:43371759-43371781 CCCTCCTCCCAGGAGGAGAAGGG + Intergenic
1009344872 6:62600948-62600970 CCCTCATGGCAGAAGGTGAAGGG - Intergenic
1009698550 6:67142984-67143006 CCCCCCTTGTAGGACATGCAAGG - Intergenic
1012884941 6:104834809-104834831 ACCTCTTTTCAAGAGGTGCATGG - Intronic
1013408609 6:109864720-109864742 AACTCCTTGCAGGAGAGGCAGGG + Intergenic
1015211936 6:130708564-130708586 CACTCATTGCAGAAGGTGGAGGG + Intergenic
1015953349 6:138575865-138575887 CCCTCCTGGCAGCAGGGCCAAGG + Intronic
1017431167 6:154372534-154372556 CCATACTTGTAGGGGGTGCAGGG - Intronic
1018905265 6:168072209-168072231 CCCTCCCAGCAGGGGGTGCAGGG - Intronic
1019378795 7:711032-711054 CTCTCCTGGAAGGAGGTTCAGGG - Intronic
1019565981 7:1679344-1679366 CCCTCCCTGCAGGAGGCTCTGGG + Intergenic
1019980814 7:4620544-4620566 CTCTCCTTGCAGGAGCAGCTGGG + Intergenic
1020805325 7:12783526-12783548 TCTATCTTGCAGGAGGTGCAAGG + Intergenic
1023521316 7:41052799-41052821 AACTCCTTGCAGTAGGTGCATGG + Intergenic
1024325851 7:48108727-48108749 CTCTCATTGCAAGTGGTGCATGG - Exonic
1024955097 7:54910330-54910352 GCCACCTTGCAGGAGGGGAAAGG - Intergenic
1025155940 7:56606003-56606025 CCTTCCTTGCATGAGGTGGGGGG - Intergenic
1025942752 7:66086157-66086179 GCCTACTTGAATGAGGTGCAGGG + Intronic
1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG + Intergenic
1031986346 7:128166934-128166956 TCCTCCCTGGAGGAGGTGCGGGG + Intergenic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1032858847 7:135858968-135858990 CCCTACTTGCACGTGGAGCATGG - Intergenic
1034786947 7:153934994-153935016 CCATCCTGGCTGGAGGTGCAGGG + Intronic
1034905902 7:154945631-154945653 GCCTCATTGCAGGAGGCCCAGGG + Intronic
1035086191 7:156260345-156260367 TTCTCCTTGCAGGGAGTGCAGGG - Intergenic
1035278460 7:157762814-157762836 CCCTCCCTGCATGCGGTGCCTGG - Intronic
1038460227 8:27709846-27709868 CCCTCCCTGCAGGTGGTTGAAGG + Intergenic
1039048102 8:33468312-33468334 CCCTAGTTGCAGGAGAGGCAAGG + Intronic
1041073030 8:54143702-54143724 CCAGCCTTGCAGGAGCAGCACGG - Intronic
1042203715 8:66307125-66307147 CCTTCCTTGCAGCTGGTGAATGG + Intergenic
1042405199 8:68396806-68396828 CCCTCATGGCAGAAGGTGAAGGG - Intronic
1043172193 8:76979530-76979552 ACATCCTTGCAGGAGGAGCCAGG - Intergenic
1044271788 8:90253248-90253270 CTCTCCTTGCAGGAGGTTGGGGG - Intergenic
1045459129 8:102411897-102411919 CGCTCCTTGCGGGAGGGGGAAGG + Intronic
1047476063 8:125231830-125231852 TCCTTCTTTCAAGAGGTGCATGG - Intronic
1048016262 8:130500230-130500252 CCCTCCTTGTAGTAGATGCTGGG + Intergenic
1048380688 8:133862452-133862474 CCTTCCTTGAAGGGGGTCCAGGG + Intergenic
1048844249 8:138591564-138591586 CCCACCTTGCGGGAGGTGCAGGG + Intronic
1049322086 8:142001964-142001986 CCCGCGTTGCAGAAGCTGCAGGG - Intergenic
1049328003 8:142034086-142034108 ACCGCCCTGCAGGAGGTGGATGG - Intergenic
1051708353 9:19904111-19904133 CACTCCTTGAAGTATGTGCAAGG + Intergenic
1053282168 9:36827445-36827467 CCCACCCTGCAGGAGGTGACTGG + Intergenic
1055168034 9:73220212-73220234 CCATCCTGGCAGAAGGTGAAAGG - Intergenic
1057589080 9:96356173-96356195 CCCTCCTGGCAGAAGGGGAAGGG - Intronic
1059419133 9:114180253-114180275 CCCTGCGTGCTGGAGGTGCTGGG + Intronic
1059438240 9:114289062-114289084 CCCTCCCTGCAGGAGGGTCTGGG + Intronic
1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG + Exonic
1060204540 9:121674808-121674830 CACTCCAGGCAAGAGGTGCATGG - Intronic
1060530534 9:124344894-124344916 CCCTCCGTGGTGGAGGAGCAGGG + Intronic
1060543993 9:124450022-124450044 CCTTCCTCGCAGCAGGTGGAAGG + Intergenic
1060725480 9:126003137-126003159 CCGACTTTTCAGGAGGTGCAGGG + Intergenic
1061114286 9:128598951-128598973 CTCTCCTTGTAGGAAGTGTATGG + Exonic
1061367804 9:130181663-130181685 CCCTGCTTGGTGGAGGTGCCAGG + Intronic
1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG + Intronic
1061960464 9:133986210-133986232 GCCTCCTAGCAGGTGGTCCAGGG - Intronic
1062035537 9:134380984-134381006 CCCAGCGGGCAGGAGGTGCAGGG + Intronic
1186121256 X:6363674-6363696 CCCAGCTAGCAAGAGGTGCAGGG - Intergenic
1186430895 X:9503465-9503487 CCCTCCCTGCAGGAGTTCAAAGG - Intronic
1189286487 X:39855485-39855507 AGCTCCTTTCAGGAGCTGCAGGG - Intergenic
1193232340 X:79062626-79062648 GCCTCATGGCAGGAGGTGAAAGG - Intergenic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1198582562 X:138082107-138082129 GACTCTTTGCAGGAGGTGTAGGG + Intergenic
1199785074 X:151098047-151098069 CACTCATTGCAGAAGGTGAAGGG - Intergenic
1200536849 Y:4408363-4408385 CTCTCATGGCAGGAGGTGTAAGG - Intergenic
1201860033 Y:18586783-18586805 CTTTCCTTGCTGGAGGTGCAGGG - Intronic
1201873288 Y:18733598-18733620 CTTTCCTTGCTGGAGGTGCAGGG + Intronic