ID: 1059468059

View in Genome Browser
Species Human (GRCh38)
Location 9:114481971-114481993
Sequence ACGATGCCTTGTCTCTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059468059_1059468062 14 Left 1059468059 9:114481971-114481993 CCTGGTGAGAGACAAGGCATCGT 0: 1
1: 1
2: 1
3: 4
4: 74
Right 1059468062 9:114482008-114482030 GTCCTTATGACACTTGAGCCTGG No data
1059468059_1059468065 20 Left 1059468059 9:114481971-114481993 CCTGGTGAGAGACAAGGCATCGT 0: 1
1: 1
2: 1
3: 4
4: 74
Right 1059468065 9:114482014-114482036 ATGACACTTGAGCCTGGTGAGGG No data
1059468059_1059468064 19 Left 1059468059 9:114481971-114481993 CCTGGTGAGAGACAAGGCATCGT 0: 1
1: 1
2: 1
3: 4
4: 74
Right 1059468064 9:114482013-114482035 TATGACACTTGAGCCTGGTGAGG No data
1059468059_1059468061 -8 Left 1059468059 9:114481971-114481993 CCTGGTGAGAGACAAGGCATCGT 0: 1
1: 1
2: 1
3: 4
4: 74
Right 1059468061 9:114481986-114482008 GGCATCGTGTGGCACACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059468059 Original CRISPR ACGATGCCTTGTCTCTCACC AGG (reversed) Intronic
900465857 1:2825145-2825167 AGGGTGCTTTGTCTCCCACCAGG + Intergenic
901134793 1:6986183-6986205 CTGCTGCCATGTCTCTCACCAGG + Intronic
901956947 1:12793275-12793297 ACAAGGCCTGGTCTCTCAGCAGG - Exonic
901964953 1:12859057-12859079 ACAAGGCCTGGTCTCTCAGCAGG - Exonic
901980342 1:13029411-13029433 ACAAGGCCTGGTCTCTCAGCAGG - Intronic
902001745 1:13199520-13199542 ACAAGGCCTGGTCTCTCAGCAGG + Intergenic
902020973 1:13345245-13345267 ACAAGGCCTGGTCTCTCAGCAGG + Exonic
902097348 1:13957658-13957680 ACCTTGCTTTCTCTCTCACCCGG - Intergenic
903502024 1:23805856-23805878 TCCTTGCCATGTCTCTCACCTGG + Intronic
908400259 1:63766277-63766299 ACAATGCCTTCTCTCTTACAAGG - Intergenic
918520557 1:185410282-185410304 CAGATGCCTTGTCTGTCTCCTGG + Intergenic
919380211 1:196849718-196849740 ATAATGCCTTGTCTTTCACTTGG - Intronic
923367572 1:233277792-233277814 ACGGTGCCTTGACTCTCCACAGG + Intronic
1078883041 11:15472062-15472084 ATCATGACTTGCCTCTCACCAGG + Intergenic
1084095448 11:66908188-66908210 CAGATGCCCTGTCTCTCTCCTGG - Intronic
1084274647 11:68045099-68045121 AGGATGCCGTGGCTCTCACCGGG - Exonic
1088911198 11:114193714-114193736 ACGGTACCTGGTCTCCCACCTGG - Intronic
1091333573 11:134750141-134750163 ACATTGCCTTGACTCACACCTGG - Intergenic
1091891067 12:4055000-4055022 CCTTCGCCTTGTCTCTCACCTGG - Intergenic
1092459419 12:8673169-8673191 ACCATGCCTGGCCTCTGACCGGG + Intergenic
1094629753 12:32161799-32161821 TCTATGCCATGTCTATCACCTGG + Intronic
1114229786 14:20770138-20770160 ACGATGCCATCTCAGTCACCGGG - Exonic
1117740608 14:58815618-58815640 ACCCTGCCTTGTTTCTCACTGGG + Intergenic
1121914996 14:97830646-97830668 AAGTTGCCATGTCTCTCATCAGG + Intergenic
1122207216 14:100153798-100153820 CAGATGCCTTGTGCCTCACCTGG - Intronic
1124642893 15:31408265-31408287 AAGATGAATTGTTTCTCACCAGG + Intronic
1133309144 16:4831632-4831654 TCCAGGCCGTGTCTCTCACCTGG + Intronic
1135436544 16:22430824-22430846 ACGCTTCCTTGTCACACACCCGG - Intronic
1136263715 16:29101091-29101113 ACGCTTCCTTGTCACACACCCGG + Intergenic
1139049326 16:63104086-63104108 AAGATCTCTTGTCTGTCACCTGG + Intergenic
1141157173 16:81605385-81605407 AGGCAGCCTTGTCGCTCACCTGG + Intronic
1143313679 17:6014830-6014852 ACCATGCCCAGTCTGTCACCTGG - Intronic
1149009684 17:51842606-51842628 ACGATGCCTTATCTTTTACAAGG - Intronic
1154450630 18:14473195-14473217 ATGAAGCTTTGTCTCTTACCTGG + Intergenic
1162498384 19:11036131-11036153 AGGATGGCCTGTCTGTCACCTGG - Intronic
928256045 2:29723395-29723417 ACAATGAGTTGTCTCTCAGCAGG - Intronic
930173922 2:48281853-48281875 AGGAGGCCTTGTTTGTCACCAGG + Intergenic
937488654 2:122342244-122342266 AGGAGGCCTCCTCTCTCACCAGG - Intergenic
937688813 2:124729999-124730021 CCTATTCCTTGTCTCTCATCAGG - Intronic
942546031 2:177064572-177064594 ACGATGCCTTCTCTTGCCCCTGG + Intergenic
945557899 2:211301760-211301782 AAGAGGCCTTGTTTCTGACCAGG + Intergenic
946433411 2:219637542-219637564 AGGATGCCTTGTCACTCACCTGG - Intronic
947223754 2:227820501-227820523 AGGATGCCTTTGCTCTCCCCTGG + Intergenic
947359835 2:229335659-229335681 ACTATGGATTGTTTCTCACCAGG + Intergenic
1168896792 20:1329155-1329177 ACGTAGCCCTGTCTCTCAGCTGG + Intronic
1175025276 20:55895358-55895380 ATTATGCCTTGTCTCTATCCAGG + Intergenic
1177763788 21:25433843-25433865 AGGTTGCCATGTCCCTCACCTGG - Intergenic
1180722506 22:17920041-17920063 ATGTTGCCTTGTCTGACACCTGG - Intronic
1182458853 22:30470290-30470312 AAGATGCCTTGTCTTACTCCTGG + Intronic
1184839340 22:47043421-47043443 ACCATGCTATGTCTCTCACCTGG - Intronic
961246238 3:125456369-125456391 ACCATGCCTAGTCTATCATCTGG - Intronic
964434710 3:156639419-156639441 AAGCTGCCTTATCTCTCACCTGG + Intergenic
970457132 4:16235935-16235957 ACCATGCCCTGTCTTTCAACTGG - Intergenic
973667491 4:53177687-53177709 GCGATGCCTTGGCTCGCACACGG - Intronic
977861299 4:101963766-101963788 CCGAGGCCTTTTCTCGCACCTGG + Intronic
978172621 4:105692032-105692054 TCGCTTCCTTGTCTGTCACCTGG + Exonic
986684313 5:10262509-10262531 ACGATGCTTTGTGTGTCATCCGG + Exonic
996203969 5:120707937-120707959 ATGAAGACTTCTCTCTCACCAGG - Intergenic
998380232 5:141719198-141719220 ACTCTGGCTGGTCTCTCACCCGG + Intergenic
1012066990 6:94560249-94560271 AAGATAACATGTCTCTCACCTGG + Intergenic
1017379954 6:153816671-153816693 ACGATTTATTGACTCTCACCTGG + Intergenic
1018068628 6:160141839-160141861 ACGATGCCTGGGCTCTGTCCAGG - Intronic
1023856697 7:44188532-44188554 AAGATGCCTTGCCTCCTACCAGG - Intronic
1028238821 7:88394304-88394326 ACGATGAATTATCTCTTACCTGG - Intergenic
1033451773 7:141468354-141468376 CAGATGCCTTCTCTCTCACTCGG - Intronic
1034999035 7:155596681-155596703 AAAATGCCTAGTCTCTCTCCAGG + Intergenic
1037779436 8:21857661-21857683 ACGATGCATTATTTCTAACCGGG + Intergenic
1039868622 8:41527631-41527653 AAGATGCCTACTCTCTCACTCGG + Intergenic
1047266217 8:123311788-123311810 AAAATGCCTTTTCTCTCCCCAGG - Intergenic
1050632742 9:7578030-7578052 AGAATGCCTTGTCTCACATCTGG - Intergenic
1051202577 9:14644430-14644452 TCAATGCCTTGTCTCCAACCTGG + Intronic
1056364952 9:85895004-85895026 CTGATGCCTTGTCTTGCACCTGG + Intergenic
1059468047 9:114481863-114481885 GCAATGCCTTGTTCCTCACCAGG - Intronic
1059468053 9:114481918-114481940 GCAATGCCTTGTCTCTCACGAGG - Intronic
1059468059 9:114481971-114481993 ACGATGCCTTGTCTCTCACCAGG - Intronic
1059468075 9:114482134-114482156 ATGATGCCTTGTCTCTCACCAGG - Intronic
1059468080 9:114482191-114482213 ATGATTCTTTATCTCTCACCAGG - Intronic
1059985272 9:119814954-119814976 ACTAATCCTTGTCTCACACCTGG - Intergenic
1187673861 X:21696362-21696384 ACCATACCTGGTCTCTCAACAGG + Intergenic
1195696435 X:107671084-107671106 ATGCTGCCTTGTCTAACACCAGG - Intergenic
1200966308 Y:9041948-9041970 ACGAGGCCTTGGCGCACACCTGG - Intergenic