ID: 1059468062

View in Genome Browser
Species Human (GRCh38)
Location 9:114482008-114482030
Sequence GTCCTTATGACACTTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059468059_1059468062 14 Left 1059468059 9:114481971-114481993 CCTGGTGAGAGACAAGGCATCGT 0: 1
1: 1
2: 1
3: 4
4: 74
Right 1059468062 9:114482008-114482030 GTCCTTATGACACTTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059468062 Original CRISPR GTCCTTATGACACTTGAGCC TGG Intronic
No off target data available for this crispr