ID: 1059470102

View in Genome Browser
Species Human (GRCh38)
Location 9:114498516-114498538
Sequence AGCACTGCTCAGAGAATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059470101_1059470102 -10 Left 1059470101 9:114498503-114498525 CCTGTGTGTGGTAAGCACTGCTC 0: 1
1: 0
2: 0
3: 26
4: 202
Right 1059470102 9:114498516-114498538 AGCACTGCTCAGAGAATGTATGG No data
1059470098_1059470102 8 Left 1059470098 9:114498485-114498507 CCAAGTATCAGCCACAGGCCTGT 0: 1
1: 0
2: 1
3: 11
4: 172
Right 1059470102 9:114498516-114498538 AGCACTGCTCAGAGAATGTATGG No data
1059470100_1059470102 -3 Left 1059470100 9:114498496-114498518 CCACAGGCCTGTGTGTGGTAAGC 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1059470102 9:114498516-114498538 AGCACTGCTCAGAGAATGTATGG No data
1059470096_1059470102 26 Left 1059470096 9:114498467-114498489 CCTATTCATCTCTGATGTCCAAG 0: 1
1: 0
2: 0
3: 7
4: 169
Right 1059470102 9:114498516-114498538 AGCACTGCTCAGAGAATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059470102 Original CRISPR AGCACTGCTCAGAGAATGTA TGG Intronic
No off target data available for this crispr