ID: 1059471117

View in Genome Browser
Species Human (GRCh38)
Location 9:114505377-114505399
Sequence GCCCCGGGATGCAGCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059471109_1059471117 8 Left 1059471109 9:114505346-114505368 CCGACAAGGGGTGCGGGGCATGT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG 0: 1
1: 0
2: 2
3: 20
4: 236
1059471102_1059471117 29 Left 1059471102 9:114505325-114505347 CCGGTGAAGCGGCGCGGGCGTCC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG 0: 1
1: 0
2: 2
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059471117 Original CRISPR GCCCCGGGATGCAGCCGCCC GGG Intronic
900105263 1:978384-978406 GCCCCGGGAACCGCCCGCCCTGG + Intronic
900226461 1:1535546-1535568 GCCCGGGAGTGCTGCCGCCCTGG - Intronic
900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG + Intergenic
900518705 1:3095483-3095505 GCCCCGGGACACAGCCGCACAGG - Intronic
901631594 1:10650863-10650885 GCCCCGGGGTGGTCCCGCCCAGG - Intronic
902466870 1:16624021-16624043 GCCCTGGGACTCAGCCTCCCTGG + Intergenic
902507730 1:16948753-16948775 GCCCTGGGACTCAGCCTCCCTGG - Intronic
903809946 1:26029596-26029618 GCACTGGGATGCAGCCGGCCTGG - Exonic
904236570 1:29121124-29121146 GCCCCGGGCTGCCCCCACCCTGG - Exonic
905293656 1:36940616-36940638 GCCCCGGGAGGCAGGCCCCAAGG - Intronic
905584487 1:39105844-39105866 GCCCCGAGAAGCAGCAGCTCAGG - Intronic
909585191 1:77281751-77281773 GCCCAGGGATGCAGCTACCGGGG - Intergenic
910251096 1:85200574-85200596 GCCGGTGGGTGCAGCCGCCCGGG + Exonic
913193478 1:116433257-116433279 GCCTTGGGCTGCAGCTGCCCTGG - Intergenic
919182155 1:194100499-194100521 ACCCCGTGATCCAGCCGCCTCGG + Intergenic
920385573 1:205568713-205568735 GCCTCCGGATGCAGCCCCCAGGG - Intergenic
922796362 1:228341662-228341684 GCACCCGGCTGCAGCCGCACAGG + Intronic
923369395 1:233295475-233295497 GCCCCGGGGCGCAGCCGGCATGG - Exonic
924042665 1:239998256-239998278 TTCGCGGGGTGCAGCCGCCCGGG + Intergenic
1064208888 10:13347551-13347573 ACGCCGGGACGCACCCGCCCCGG + Intronic
1065333960 10:24635776-24635798 ACCCCGTGATTCACCCGCCCTGG + Intronic
1067769934 10:49115614-49115636 GCCTCGGGACCCAGCAGCCCCGG - Intergenic
1070783435 10:79150164-79150186 GCCCCGGGCCGCAGCCGTGCAGG + Intronic
1075119286 10:119652075-119652097 GCCCCGGGATTCGGTGGCCCGGG + Intronic
1076096112 10:127736301-127736323 GCCCGGGGTTGCTGCAGCCCGGG - Intergenic
1077105946 11:842708-842730 GCCCCGGGACGCACAGGCCCAGG - Intergenic
1077194447 11:1272299-1272321 GCCCCGGCCTGCAGCACCCCAGG + Intergenic
1077269096 11:1666640-1666662 GTCCCCGGATGGGGCCGCCCCGG + Intergenic
1077271451 11:1684074-1684096 GTCCCCGGATGGGGCCGCCCCGG - Intergenic
1077432068 11:2520611-2520633 GCCCTGGGATGTGGACGCCCAGG - Intronic
1078066303 11:8081402-8081424 GCCCCGGGCCGCATCCTCCCGGG - Intronic
1078090747 11:8263113-8263135 GCCCCGGGCTGCACGCGCCCGGG - Intronic
1078128682 11:8594006-8594028 GGCCCGGGGCGCAGCCGGCCAGG - Intronic
1080836499 11:35944874-35944896 GCCCCGGGATGCACACGCGGTGG - Intronic
1081528491 11:43942808-43942830 GCCCCCGGCTGCTGCCTCCCGGG + Exonic
1081528494 11:43942810-43942832 CCCCCGGGAGGCAGCAGCCGGGG - Exonic
1081611280 11:44565093-44565115 GCACCCGGATACACCCGCCCTGG + Intronic
1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG + Intergenic
1083174256 11:60939386-60939408 CCCCAGGGATGCAGCCCCCAGGG - Intronic
1083227650 11:61294945-61294967 ACACCGGGAGGAAGCCGCCCGGG - Exonic
1084090653 11:66877454-66877476 ACCTCGTGATGCACCCGCCCTGG - Intronic
1085396436 11:76209255-76209277 GGCCCGGGAGGCGGCCGCCTGGG + Intronic
1088897559 11:114089908-114089930 GCCCCTGCTTGCAGCCTCCCTGG + Intronic
1090667534 11:128924731-128924753 GCCCAGGGAAGCAGCAGCCTTGG + Intergenic
1091778683 12:3200525-3200547 GCACCGGGATCCAGGCTCCCTGG - Intronic
1091821888 12:3481540-3481562 GTACTGGGATGCAGCAGCCCTGG + Intronic
1103923226 12:124410324-124410346 GCCCAGGGATGGAGCAGACCGGG - Intronic
1104004323 12:124881494-124881516 TCTCTGGGATGCAGCCACCCTGG + Intronic
1104371612 12:128228582-128228604 GCCCAAGGATGCAGCTTCCCTGG + Intergenic
1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG + Intronic
1108373285 13:49792098-49792120 GAACGGGGATGCTGCCGCCCGGG - Intronic
1116862114 14:50003293-50003315 GCTCACGGCTGCAGCCGCCCGGG + Intronic
1121728530 14:96170419-96170441 GCTCCAGGATGAAGCCGCACAGG - Intergenic
1122163671 14:99804932-99804954 GGCCCTGGATGCAGCCACCCTGG + Intronic
1122320298 14:100851478-100851500 GCCCCGGGACCCAGGAGCCCTGG + Intergenic
1123037281 14:105476645-105476667 GCCCTGGGCTGCAGCTGCCACGG + Intronic
1123067699 14:105626774-105626796 GCCCCAGTGTGCAGCAGCCCAGG + Intergenic
1123071718 14:105645499-105645521 GCCCCAGTGTGCAGCAGCCCAGG + Intergenic
1123091382 14:105743775-105743797 GCCCCAGTGTGCAGCAGCCCAGG + Intergenic
1123097153 14:105772116-105772138 GCCCCAGTGTGCAGCAGCCCAGG + Intergenic
1124983323 15:34583464-34583486 GCCCCAGGTTGCCGCCGCCAGGG + Intronic
1125375422 15:39023917-39023939 GCCTCGGGATGCAGGAGACCAGG + Intergenic
1126436714 15:48645117-48645139 GCCCCCGGCGGCAGCAGCCCCGG + Intronic
1126789137 15:52204693-52204715 GCCCCGGGATGCTGGCGCCCAGG - Intronic
1128721671 15:69954941-69954963 GCCTCTGGATGCAGCCAGCCTGG - Intergenic
1129742014 15:77993852-77993874 GCACCTGCAGGCAGCCGCCCTGG - Intronic
1132111061 15:99102733-99102755 GCTCCAGCATGCAGCTGCCCCGG - Intronic
1132821171 16:1872003-1872025 GGCCCGGGGAGCAGCCGGCCGGG - Exonic
1133156347 16:3879796-3879818 GCCCCGGGCCCCCGCCGCCCCGG + Intronic
1133189428 16:4122506-4122528 ACCTCGTGATCCAGCCGCCCTGG - Intergenic
1134043945 16:11087918-11087940 CCCCCGCTGTGCAGCCGCCCTGG + Intronic
1136514799 16:30761775-30761797 GCCCCGGGCTCCCGCCGCCTAGG + Exonic
1137585477 16:49661748-49661770 CCCCCGGAATGCAGCCTCCATGG - Intronic
1137787712 16:51151791-51151813 TCCCCGGAATTGAGCCGCCCCGG + Intergenic
1141694453 16:85613069-85613091 GCGCCCGGATCCACCCGCCCAGG - Intronic
1141972418 16:87492677-87492699 GCCCCCCGACGGAGCCGCCCCGG + Intergenic
1142176882 16:88649549-88649571 GCCCCAGGAGGCAGCTGGCCCGG - Intronic
1142251307 16:88993275-88993297 GCCCCGGGCTGCAGCTGGGCAGG + Intergenic
1142836931 17:2594054-2594076 GGTCCGGCCTGCAGCCGCCCGGG - Intronic
1143259001 17:5584428-5584450 GCCCCGGGCTGCTGGCTCCCAGG + Exonic
1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG + Intronic
1144269234 17:13601266-13601288 GTCCCGGGAGGCAGCGGCCGGGG + Exonic
1144854233 17:18259054-18259076 GCCCCGGGGCGCAGAGGCCCAGG + Intergenic
1145019175 17:19416351-19416373 GCCCCCAGATGCTGCCTCCCAGG - Exonic
1147193542 17:38750186-38750208 GCCCCGAGGGGCAGCCCCCCAGG - Exonic
1148596831 17:48863276-48863298 GCCCTGGGATGGAGCCAACCTGG + Exonic
1150676099 17:67246311-67246333 ACCCCGGCGTCCAGCCGCCCAGG + Intergenic
1151680393 17:75619906-75619928 GCTCCAGGGTGGAGCCGCCCCGG - Intergenic
1151805915 17:76405341-76405363 GTCCCGTGGTGCAGCAGCCCTGG + Intronic
1152092455 17:78254521-78254543 GAGCTGGGAAGCAGCCGCCCTGG + Intergenic
1153219024 18:2846650-2846672 GCCCCGGGAGGCTGGCACCCAGG + Intergenic
1154384287 18:13879611-13879633 GCCCTGGGATGCTGATGCCCTGG - Intergenic
1156993696 18:43440481-43440503 GCCCCGGGATCCAGCCACACAGG + Intergenic
1157483652 18:48072405-48072427 GCCAATGGATGCAGCCACCCAGG - Intronic
1159655684 18:71028538-71028560 TCCCTGGGATGCTGCCGCCCGGG + Intergenic
1160987983 19:1848377-1848399 GCCCCGGCCCGGAGCCGCCCGGG + Exonic
1161054356 19:2182556-2182578 GCCCCGGGAAGCCACAGCCCTGG - Intronic
1161222087 19:3122475-3122497 GCCCCGGGAGGCGGCCCCCGGGG - Exonic
1161222380 19:3123588-3123610 GCCGGGGGCTGCTGCCGCCCGGG - Exonic
1161563009 19:4984133-4984155 TCCCTGGGATGAGGCCGCCCGGG - Intronic
1161779335 19:6280302-6280324 CCCCCGGGACGCTCCCGCCCTGG - Intergenic
1161953812 19:7482110-7482132 GACCCGGGCATCAGCCGCCCAGG + Exonic
1162036551 19:7943295-7943317 TCCACGGGACGCCGCCGCCCCGG + Intronic
1162792544 19:13070491-13070513 GGCCCTGGCTGCAGCTGCCCCGG + Intronic
1162958898 19:14114653-14114675 GCCCCAGGGGGCAGGCGCCCAGG - Intronic
1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG + Intronic
1163696051 19:18764109-18764131 GCCCCGGTGAGCAGCTGCCCTGG + Intronic
1165705031 19:37969616-37969638 CCCCCGTGATGCAGCCGTGCTGG + Intronic
1166688361 19:44809130-44809152 GCCCCCGGACGCACCGGCCCAGG + Exonic
1166984151 19:46649606-46649628 GCGCCGAGATGTAGCCGTCCAGG + Exonic
1166986115 19:46660827-46660849 GCGCCGGGCCGCAGCGGCCCTGG - Exonic
1167413730 19:49360045-49360067 ACCCCGGGCTGGGGCCGCCCTGG - Exonic
1168315244 19:55482165-55482187 GCCCCAGGAGGCACCCGCCGAGG + Exonic
926268133 2:11344507-11344529 GCCCCGGGAGGCTGAAGCCCAGG + Exonic
926425082 2:12732748-12732770 GCCCTTGGTAGCAGCCGCCCCGG + Intronic
928181005 2:29068660-29068682 GCCCAGGCATGCAGCCGCAATGG - Intronic
931253823 2:60554047-60554069 GCACCGGGAGGCTGCAGCCCCGG + Intergenic
933990859 2:87632997-87633019 GCCCCTGCATGCATCTGCCCTGG - Intergenic
934105527 2:88691691-88691713 GCGTCGGGATGCAGCGCCCCGGG + Exonic
935173396 2:100628153-100628175 CCCCTGGGATGCAGCTGCCTTGG - Intergenic
935265106 2:101387178-101387200 GCCCCGGGCGGGCGCCGCCCGGG - Exonic
935653182 2:105399192-105399214 GCCCCGGGCTGCGGCGGTCCCGG + Intronic
936058322 2:109278280-109278302 GCCCCGTGCTTCAGCCACCCTGG + Intronic
936302983 2:111317826-111317848 GCCCCTGCATGCATCTGCCCTGG + Intergenic
937004221 2:118496617-118496639 GCTGTGGGATGCGGCCGCCCTGG + Intergenic
937932979 2:127219954-127219976 GCCCCGGGAGGGAGCCAGCCCGG - Intronic
938406307 2:131035044-131035066 GCCCCGAGATCCCGCCGCACAGG - Intronic
938767364 2:134469232-134469254 CCCCCGAGATGAAGCCTCCCAGG - Intronic
938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG + Intergenic
942346169 2:175005047-175005069 GTCCCGGCCTGCAGCCTCCCCGG - Exonic
942674609 2:178413721-178413743 GGGCAGGGATACAGCCGCCCGGG + Intergenic
947753364 2:232544256-232544278 GCCCCGGTATGCTGCCTCCATGG + Intronic
948725000 2:239929144-239929166 AAGCCGGGATGCAGCCACCCAGG + Intronic
948887265 2:240890505-240890527 ACCCCTGGAGGCTGCCGCCCTGG - Intronic
1172120657 20:32596871-32596893 TCCCTGGGATGCAGCTGTCCAGG - Intronic
1173985814 20:47260419-47260441 TCACTGGGATGCAGCCACCCTGG + Intronic
1174287672 20:49483944-49483966 GCCCCAGGAGGCGGCCGCCCTGG - Intergenic
1174304478 20:49605441-49605463 GCCCCCAGAAGCAGCCGCCAAGG + Intergenic
1175160669 20:57005389-57005411 GCCCCAGGATGCACCTGCTCAGG - Intergenic
1175859401 20:62142588-62142610 GGGCCGGGCTGCAGCCGCCCGGG - Intronic
1175959190 20:62626445-62626467 CACCCGGGGTGCAGCCTCCCAGG + Intergenic
1175964807 20:62655229-62655251 GCCCCGGGAAGGACCCTCCCAGG + Intronic
1175964825 20:62655285-62655307 GCCCCGGGAAGGACCCTCCCAGG + Intronic
1175964843 20:62655341-62655363 GCCCCGGGAAGGACCCTCCCAGG + Intronic
1176014889 20:62926064-62926086 GCCCCGGGCCGCACTCGCCCAGG + Intronic
1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG + Intergenic
1180614669 22:17119757-17119779 GCCCCAGGATGCAGCCGCTGCGG + Exonic
1180636022 22:17263747-17263769 CACCAGGGATGCTGCCGCCCTGG - Intergenic
1181035002 22:20165626-20165648 CCCCCAGGATGGGGCCGCCCTGG - Intergenic
1181035897 22:20169604-20169626 GCCCTGGGGGGCAGCAGCCCAGG + Intergenic
1181508820 22:23379733-23379755 CCCCCAGGATGGGGCCGCCCTGG + Intergenic
1181934635 22:26429644-26429666 GGGCCGGGATGCGGGCGCCCGGG - Intronic
1182421158 22:30249174-30249196 CCCCCAGGAATCAGCCGCCCAGG + Intergenic
1184034119 22:41910510-41910532 GCCCCGGGGGTCGGCCGCCCCGG - Exonic
1184474092 22:44711369-44711391 GCCCCAGGCTGAAGCTGCCCTGG - Intronic
1184728378 22:46358933-46358955 GCCTCGGGAAGGAGCCTCCCAGG - Intergenic
1184750818 22:46485484-46485506 GGCCCCGCATGCAGCCTCCCAGG - Intronic
1185150781 22:49162851-49162873 GCCCTGGGCTGCACCTGCCCAGG - Intergenic
1185387843 22:50544520-50544542 CCCCCGGGGTGCAACTGCCCTGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
952818784 3:37468168-37468190 GCCCTGGGATGCACCTCCCCAGG - Intronic
954434611 3:50489548-50489570 GCCCAGGGGAGCAGCAGCCCCGG + Intronic
954660584 3:52224795-52224817 TCCCTGGGAGGCAGCCGGCCTGG - Intronic
955984096 3:64555430-64555452 GCCCCGGGAGGCAGCCTCCATGG + Intronic
962847243 3:139283469-139283491 GCCCGGGGCTGCAGCCACCTGGG + Intronic
968671888 4:1856354-1856376 GCCCCAGGAGCCAGCCGCCCCGG - Intergenic
968764770 4:2462630-2462652 GCCCCGGCTTTCAGTCGCCCGGG - Intronic
969094236 4:4719951-4719973 GCCCTGTGATGCAGCAGCCCCGG + Intergenic
982122779 4:152158475-152158497 GCTCTGGGCTGCAGCCACCCTGG - Intergenic
983361145 4:166724925-166724947 GGCTCGGGTTGCAGCCACCCTGG + Intergenic
985828201 5:2208187-2208209 GACCTGGGATGCTGCCGGCCGGG - Intergenic
990581804 5:57173510-57173532 GCGCCGGGAAGCGGCCGCGCAGG - Intergenic
991587810 5:68216715-68216737 GCTCCGGGTTGCAGGCTCCCTGG - Intronic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG + Intronic
995462762 5:112420057-112420079 GCCCCGGGCGGGAGCAGCCCAGG + Intergenic
998435871 5:142108652-142108674 GCCCCGAGGTGCACCGGCCCTGG - Exonic
1002065006 5:176647529-176647551 GCCCTGGGCTAGAGCCGCCCGGG - Exonic
1002140515 5:177134535-177134557 GCTCTGGGGTGCAGCCGCCTCGG + Intronic
1003012085 6:2435632-2435654 GCCCCGTTAAGCAGCAGCCCTGG - Intergenic
1003076122 6:2985173-2985195 CCCCTGGGATCCTGCCGCCCTGG + Intergenic
1005299161 6:24454124-24454146 GCACCAGGCTACAGCCGCCCCGG - Exonic
1005751481 6:28886789-28886811 GCCCCGTGATCCACCCGCCTCGG - Intergenic
1006359700 6:33580278-33580300 GCCACCGGATGCAGACGCACAGG + Intronic
1006861041 6:37171500-37171522 GGCCCGGGAGGGAGCTGCCCAGG + Intronic
1008856901 6:56099467-56099489 GCCTCGTGATCCAGCCGCCTCGG + Intronic
1012401120 6:98843552-98843574 GCCCCTGGAAGGAGTCGCCCCGG + Intergenic
1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG + Intronic
1017876582 6:158529792-158529814 GCCCAGCGATGCAGCCTCCTGGG - Intergenic
1018231373 6:161679293-161679315 GCCCCAGGATACAGCCTCCCTGG - Intronic
1019140842 6:169941195-169941217 GTCCAGGGATGCACCGGCCCTGG + Intergenic
1019291674 7:253583-253605 GCCACGGGAGGCAGCTGTCCAGG - Intronic
1019322207 7:420888-420910 GCTCCGGGGAGCAGCAGCCCTGG + Intergenic
1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG + Intronic
1019892270 7:3955935-3955957 GCCCCTGGAGGCAGCTGCCATGG + Intronic
1020125971 7:5532645-5532667 GCCCCGGGCTGCAGCATTCCTGG + Intronic
1020234978 7:6348498-6348520 CCCGCGGGATGCAGACGCCACGG - Intronic
1022113790 7:27246284-27246306 GCCCCGGGCTGCCGCCGCCTCGG + Exonic
1022446981 7:30478749-30478771 GGCCCGCGAGGCAGCCGCCCCGG - Exonic
1025943390 7:66089225-66089247 GACCCGGGATCCTGCCCCCCTGG - Intronic
1032068801 7:128791524-128791546 GCCGCGGGCTGGAGCTGCCCGGG + Intronic
1033406144 7:141073115-141073137 GCCCCGGGAGCCTGCCGCCCAGG - Intergenic
1033418287 7:141183873-141183895 GCCCCGGCATGCGGCCTCCTTGG + Intronic
1034223068 7:149460399-149460421 CCGCCGGGACGCAGCCGGCCGGG - Intronic
1034475124 7:151277147-151277169 GCTCCGGGCTGCAGCGGCGCAGG - Intronic
1035165819 7:156989119-156989141 GCCCCGGGCGGGAGCAGCCCTGG - Intergenic
1035183534 7:157108272-157108294 GCCCGGGACTGCAGCCGACCAGG + Intergenic
1035401697 7:158570086-158570108 GCCCCGAGAAGCCGCCGCGCCGG + Intronic
1036263438 8:7257655-7257677 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036264741 8:7265277-7265299 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036266040 8:7272899-7272921 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036267343 8:7280521-7280543 GCCCCGGGGTGAAGCCAACCCGG + Intergenic
1036268645 8:7288143-7288165 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036297945 8:7551289-7551311 GCCCCGGGCTGAAGCCAACCCGG - Intergenic
1036299250 8:7558938-7558960 GCCCCGGGCTGAAGCCAACCCGG - Intergenic
1036300555 8:7566587-7566609 GCCCCGGGCTGAAGCCAACCCGG - Intergenic
1036301859 8:7574232-7574254 GCCCCGGGCTGAAGCCAACCCGG - Intergenic
1036303156 8:7581881-7581903 GCCCCGGGCTGAAGCCAACCCGG - Intergenic
1036315482 8:7716194-7716216 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036316790 8:7723842-7723864 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036318097 8:7731490-7731512 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036319405 8:7739138-7739160 GCCCCGGGGTGAAGCCAACCCGG + Intergenic
1036320713 8:7746785-7746807 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036322023 8:7754433-7754455 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036323332 8:7762081-7762103 GCCCCGGGTTGAAGCCAACCCGG + Intergenic
1036324627 8:7769728-7769750 GCCCCGGGGTGAAGCCAACCCGG + Intergenic
1036351407 8:8014579-8014601 GCCCCGGGTTGAAGCCAACCCGG - Intergenic
1036352712 8:8022225-8022247 GCCCCGGGGTGAAGCCAACCCGG - Intergenic
1036354004 8:8029873-8029895 GCCCCGGGCTGAAGCCAACCCGG - Intergenic
1036557153 8:9870157-9870179 ACCCCGTGATCCAGCCGCCTCGG - Intergenic
1036808980 8:11854203-11854225 AGCCCTGGATGCAGGCGCCCAGG - Intronic
1037595341 8:20349967-20349989 GCCCCGGGATGCTGAGCCCCTGG + Intergenic
1038540418 8:28386077-28386099 GCTCCGGGCTGCAGCGGCCGCGG + Intronic
1039521558 8:38176448-38176470 GCCCCGGCTTTCAGCCGCCGGGG + Exonic
1039768600 8:40659481-40659503 GCCCCTGGATGCAGAAGTCCAGG + Intronic
1045047530 8:98293937-98293959 GCGCCCGGAGCCAGCCGCCCTGG + Intronic
1045677207 8:104620429-104620451 TCCCTGGGATGCAGCCACACTGG - Intronic
1047231359 8:123000709-123000731 GCCCAGGGAAGCAGCCTCCAAGG - Intergenic
1049364114 8:142228363-142228385 GCCCTGGGCTGCAGCCGGGCAGG - Intronic
1049691077 8:143959457-143959479 GGTCCGGGATGCAGAGGCCCAGG + Intronic
1049742654 8:144248544-144248566 GCCCTGTGGTGCAGTCGCCCTGG - Intronic
1049773170 8:144393068-144393090 GACCTAGGGTGCAGCCGCCCAGG + Exonic
1051344367 9:16139107-16139129 GCACCGGGATGAAGCCACCAAGG - Intergenic
1051418619 9:16870135-16870157 GCGCTGGGGCGCAGCCGCCCGGG - Intronic
1056532369 9:87498402-87498424 GACCCGGCGTGCGGCCGCCCGGG - Intronic
1056706109 9:88953867-88953889 GCCCTGGGACCCAGCTGCCCTGG - Intergenic
1057313413 9:93955132-93955154 GCGCCGCGATGCAGCGGCCGGGG - Exonic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1060811723 9:126614240-126614262 GGCGCGGGCTGCAGCCGCCCCGG + Intergenic
1062004900 9:134234156-134234178 GCCCCTGGAGGCTGCAGCCCAGG - Intergenic
1062382535 9:136294438-136294460 GCCACGGGGTGGAGCTGCCCTGG - Intronic
1062491287 9:136806288-136806310 GCCCCGGGCTGCAGCCAGGCTGG + Intronic
1062497953 9:136840475-136840497 GCCCCGGGCGGCCGCCACCCTGG + Exonic
1203772672 EBV:57586-57608 GCCCCCGCAATCAGCCGCCCCGG - Intergenic
1185432974 X:19978-20000 GCCCCGGGCGGGAGCCGACCTGG + Intergenic
1195060748 X:101191625-101191647 GCCCGGGGAGGCCGCTGCCCGGG + Intergenic
1199802735 X:151267534-151267556 GCCCCGCCATGCAGCCTCCAAGG - Intergenic
1200071737 X:153532555-153532577 GCCCCTGGAGGCAGCAGCCAGGG + Intronic