ID: 1059471213

View in Genome Browser
Species Human (GRCh38)
Location 9:114505684-114505706
Sequence CCGGCTCTGCCGGCGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059471213_1059471225 6 Left 1059471213 9:114505684-114505706 CCCTACCCCGCCGGCAGAGCCGG No data
Right 1059471225 9:114505713-114505735 GGCTCAGAAACAGCGCTCTTCGG No data
1059471213_1059471226 9 Left 1059471213 9:114505684-114505706 CCCTACCCCGCCGGCAGAGCCGG No data
Right 1059471226 9:114505716-114505738 TCAGAAACAGCGCTCTTCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059471213 Original CRISPR CCGGCTCTGCCGGCGGGGTA GGG (reversed) Intergenic
No off target data available for this crispr