ID: 1059474916

View in Genome Browser
Species Human (GRCh38)
Location 9:114538726-114538748
Sequence ATATGAGGAGGTGAGGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059474911_1059474916 8 Left 1059474911 9:114538695-114538717 CCTACTTTGAAAACTGATTTACC No data
Right 1059474916 9:114538726-114538748 ATATGAGGAGGTGAGGCCTTTGG No data
1059474910_1059474916 19 Left 1059474910 9:114538684-114538706 CCTGCAAAATTCCTACTTTGAAA No data
Right 1059474916 9:114538726-114538748 ATATGAGGAGGTGAGGCCTTTGG No data
1059474908_1059474916 21 Left 1059474908 9:114538682-114538704 CCCCTGCAAAATTCCTACTTTGA No data
Right 1059474916 9:114538726-114538748 ATATGAGGAGGTGAGGCCTTTGG No data
1059474909_1059474916 20 Left 1059474909 9:114538683-114538705 CCCTGCAAAATTCCTACTTTGAA No data
Right 1059474916 9:114538726-114538748 ATATGAGGAGGTGAGGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059474916 Original CRISPR ATATGAGGAGGTGAGGCCTT TGG Intergenic