ID: 1059475106

View in Genome Browser
Species Human (GRCh38)
Location 9:114540306-114540328
Sequence CAGAATTATGCAAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059475102_1059475106 3 Left 1059475102 9:114540280-114540302 CCAGCAGAGGTCAGACGGCTGCT No data
Right 1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG No data
1059475101_1059475106 4 Left 1059475101 9:114540279-114540301 CCCAGCAGAGGTCAGACGGCTGC No data
Right 1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059475106 Original CRISPR CAGAATTATGCAAAGGAGGC CGG Intergenic
No off target data available for this crispr