ID: 1059476798

View in Genome Browser
Species Human (GRCh38)
Location 9:114553858-114553880
Sequence CTGGCTAAACAGATGTCCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059476798_1059476801 15 Left 1059476798 9:114553858-114553880 CCGTTGGACATCTGTTTAGCCAG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1059476801 9:114553896-114553918 TCTCATCTACTACTTGAGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 130
1059476798_1059476800 14 Left 1059476798 9:114553858-114553880 CCGTTGGACATCTGTTTAGCCAG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1059476800 9:114553895-114553917 TTCTCATCTACTACTTGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 108
1059476798_1059476802 16 Left 1059476798 9:114553858-114553880 CCGTTGGACATCTGTTTAGCCAG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1059476802 9:114553897-114553919 CTCATCTACTACTTGAGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059476798 Original CRISPR CTGGCTAAACAGATGTCCAA CGG (reversed) Intergenic
902282597 1:15385217-15385239 CTGCCTAAACAGATGTATACAGG - Intronic
905439955 1:37989400-37989422 CTGCCTGGACAGATGTCCACAGG - Intronic
906882617 1:49608659-49608681 ATTGCAAAACAGATGTCAAAAGG - Intronic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
911952936 1:104199087-104199109 CTGGGGAAAGAGATGTCCACGGG + Intergenic
915367897 1:155325582-155325604 CTGGCTATACAGGGTTCCAAGGG - Exonic
922077239 1:222258100-222258122 CTAGCTCAACAGATGTAAAAAGG + Intergenic
1063361579 10:5463429-5463451 CTGGAAGAACAGAGGTCCAAAGG - Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1068560659 10:58511833-58511855 CTGGGAAAACAGAGTTCCAAGGG + Intergenic
1071939483 10:90573252-90573274 CTGGCAAAACAGTTCCCCAAAGG - Intergenic
1073580800 10:104663930-104663952 CTGCCTTAACACATTTCCAAAGG + Intronic
1074600447 10:114908346-114908368 CATGCTAAACAGAGGCCCAAAGG - Intergenic
1076429679 10:130393028-130393050 CTGGCTACACAGATGTACTTGGG - Intergenic
1080309770 11:30876294-30876316 ATGGCTGAACAGATTTGCAATGG + Intronic
1080681327 11:34478977-34478999 CTGGTGAAACAGAAGTCCTAGGG + Exonic
1082113082 11:48298642-48298664 CTGGCTAACCAGAGGTCCTGAGG - Intergenic
1084711374 11:70845979-70846001 CTGGAGAAACAGGTGGCCAAGGG + Intronic
1085948364 11:81299694-81299716 GTGGATAAACAGATATCCAGAGG - Intergenic
1091471156 12:728848-728870 TTGGCAAAAGTGATGTCCAACGG - Intergenic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1094474093 12:30827992-30828014 GTGGCGAAACAGAATTCCAAAGG - Intergenic
1095209714 12:39478109-39478131 GTGGCCAATCAGATTTCCAAAGG + Intergenic
1097467255 12:59942728-59942750 CTGACAAATCAGATTTCCAAGGG + Intergenic
1100175146 12:92021891-92021913 CAGGCTAAACAGATGAGCATGGG + Intronic
1100871259 12:98912895-98912917 CTGGGTAAAATGATCTCCAAGGG - Intronic
1104304730 12:127599475-127599497 CAGGATAAACAGATTTTCAAGGG - Intergenic
1110967899 13:81724672-81724694 CTGGTTAGGCAGAAGTCCAAGGG + Intergenic
1112689727 13:101878252-101878274 ATGCCTACACAGATGTGCAAAGG - Intronic
1113509563 13:110842246-110842268 CTGACGAATTAGATGTCCAAAGG - Intergenic
1117157560 14:52956024-52956046 ATGGATATACAGTTGTCCAAAGG + Intergenic
1117956290 14:61125995-61126017 CTGGGGAAGCAGATGTCCCAAGG - Intergenic
1118678338 14:68212966-68212988 CTGGTTGAACAAATGTCCACTGG + Intronic
1124183801 15:27503012-27503034 CTGGTTAAACCGATGGCCATTGG + Intronic
1124924616 15:34059240-34059262 CAGGCTATACATGTGTCCAAAGG + Intronic
1129054866 15:72812018-72812040 CTGGGTACACAGAGGCCCAAAGG - Intergenic
1130758040 15:86786868-86786890 CTGGCAAAACAGTAGTACAAGGG - Intronic
1132392930 15:101451889-101451911 CTGGCTAAATATAGGTCCAGTGG - Intronic
1132486133 16:192339-192361 CTGCGTAAACAGGTGTCCAATGG + Intronic
1133411801 16:5574994-5575016 CTGGCTAACCAGATAACAAACGG + Intergenic
1135092648 16:19531582-19531604 CTGCCTCAAAAAATGTCCAAAGG - Intronic
1138425727 16:56931162-56931184 CTGAAAAAACAGATGTCCCAAGG + Intergenic
1139458520 16:67103705-67103727 CTAGCTAAAAAGCTGACCAAAGG + Intergenic
1140659190 16:77170960-77170982 GTGGCTAAACCCATGTCCTAGGG - Intergenic
1146085756 17:29827613-29827635 TTGGCTAAACACATTTCCACAGG + Intronic
1146562818 17:33886181-33886203 CTGGCTGAAGAGATGGACAAAGG + Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148461146 17:47839644-47839666 CTGGCAAAAGAGAGGGCCAAGGG + Intronic
1154498435 18:14979652-14979674 CTGCCAAAACAGATGGTCAAAGG - Intergenic
1154886066 18:20291562-20291584 CTGTCTAAAGAAATGTTCAACGG - Intergenic
1155205351 18:23553646-23553668 CTGGCTGAACAAATGTCCCTAGG + Intronic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1160058112 18:75505311-75505333 ATGGCTGAACAGATGCCAAAGGG + Intergenic
1160255563 18:77245425-77245447 CTGGCTTAACAGAAATCTAAAGG + Intergenic
1162324080 19:9988454-9988476 CTGGCTAAATAGAGGTGCAGGGG - Intronic
928300627 2:30121183-30121205 CTGGCAATACAGGTGTACAAAGG + Intergenic
929617150 2:43320458-43320480 CTGCCTCAACAGATCTGCAAAGG - Exonic
931215622 2:60241034-60241056 CTTGGTAAACAGATATCCCATGG + Intergenic
932187440 2:69710872-69710894 CTGGATAAACTGTTTTCCAAAGG - Intronic
933975632 2:87507060-87507082 CCAGCTAAAGAGAAGTCCAAGGG - Intergenic
936318192 2:111443753-111443775 CCAGCTAAAGAGAAGTCCAAGGG + Intergenic
937023056 2:118676131-118676153 ATGGGTAAACAGAAGTCCATAGG + Intergenic
939874988 2:147567731-147567753 CTGCCTAAACTGATGGCTAAAGG + Intergenic
941001789 2:160209725-160209747 CTGGCTAATCAGACCTCCACTGG - Intronic
942011034 2:171762505-171762527 CTGGTTGAAAAGGTGTCCAAGGG - Intergenic
942440876 2:176035166-176035188 CTGGTGAAACAAATGGCCAATGG - Intergenic
942901058 2:181119060-181119082 CTGGCTGAACATCTGTCCCAGGG + Intergenic
943560947 2:189461092-189461114 CTAGCTAAACAGAAGACTAAAGG - Intronic
1169673908 20:8132892-8132914 CTGCCAAAGCGGATGTCCAAGGG + Intronic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1171094712 20:22320731-22320753 CTGGCTAAACACATAGCCAAGGG - Intergenic
1173415010 20:42847391-42847413 CTGGCCATACAGAAGACCAAGGG + Intronic
1173688126 20:44938267-44938289 CTGGCCAAACAGCTATCCACTGG - Intronic
1174612296 20:51808124-51808146 ATGAATAAACAGAGGTCCAAAGG - Intergenic
1179199426 21:39202546-39202568 CTGGCCAAACATATGAACAAAGG + Intronic
1181499145 22:23305908-23305930 TTGGAAAAACAGATGACCAAGGG - Intronic
1181841418 22:25665590-25665612 CTGGCTAAACAGATATAGAATGG + Intronic
949917891 3:8978825-8978847 ATTCCTAAACAGATGTGCAATGG + Intergenic
952068432 3:29601942-29601964 CTGGCTAATCAGAGTTCCCAAGG - Intronic
952760833 3:36912758-36912780 CTGGCAACACAGATGGCCTATGG + Intronic
954886409 3:53878388-53878410 TGGTCTAAAAAGATGTCCAATGG - Exonic
957382778 3:79454926-79454948 CTGGCTGAATAGATGCCCATAGG + Intronic
965681819 3:171259634-171259656 CTGGCTAATCTCATGGCCAACGG + Intronic
965946446 3:174247940-174247962 CAGGCTAAAAACATGTCCTATGG - Intronic
972630486 4:40837480-40837502 CTGGCCCAAAAGATCTCCAAGGG + Intronic
972761902 4:42114707-42114729 CTGGCTACACAGAGGCCCAATGG + Exonic
975814575 4:78204322-78204344 CTAGCTAAACATCTGTACAATGG + Intronic
976740567 4:88352332-88352354 GTGGCAAAACAGATTACCAAAGG + Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
986034638 5:3925905-3925927 CTGACAACACAGCTGTCCAAAGG + Intergenic
986638829 5:9851676-9851698 CTGGCAAAGCAACTGTCCAATGG + Intergenic
987300531 5:16593659-16593681 TTGTCTAAGCAGATATCCAAGGG - Intronic
996476776 5:123931348-123931370 CTGGCTAGCCATATGTACAAAGG - Intergenic
997836538 5:137198437-137198459 CTGGATAAACAGCTATCAAAGGG + Intronic
999639750 5:153660639-153660661 ATGGTGAGACAGATGTCCAATGG - Intronic
1000282420 5:159793667-159793689 TTGGCTAAACACATGTTGAATGG - Intergenic
1001483708 5:172105270-172105292 CTGGGTGAGCAGATGTCCACAGG - Intronic
1006279357 6:33036364-33036386 CTGGGAAATGAGATGTCCAAGGG - Intergenic
1009380268 6:63019302-63019324 TTGCCTAAATAGATTTCCAAAGG + Intergenic
1010049146 6:71482877-71482899 TTAGCTAGACAGATGTCCAGTGG - Intergenic
1010079697 6:71846150-71846172 ATGTCTAAACACATGACCAAAGG - Intergenic
1012442556 6:99274976-99274998 GTGGCTAAACAGATAGCAAAGGG - Exonic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1028247006 7:88491327-88491349 CTGCCTAAAGAGATGTTCAAGGG - Intergenic
1030394940 7:108974257-108974279 CTGGCTAAGCAGATGGACTATGG + Intergenic
1035622508 8:1044506-1044528 CTGGCAAAGCAAATGTCCTATGG - Intergenic
1043890878 8:85651609-85651631 CTGGCTAGCCATATGTCCGAAGG - Intergenic
1043893611 8:85718894-85718916 CTGGCTAGCCATATGTCCGAAGG + Intergenic
1043896292 8:85740343-85740365 CTGGCTAGCCATATGTCCAAAGG + Intergenic
1043898711 8:85759832-85759854 CTGGCTAGCCATATGTCCGAAGG - Intergenic
1043900324 8:85772026-85772048 CTGGCTAGCCATATGTCCGAAGG - Intergenic
1043902286 8:85787301-85787323 CTGGCTAGCCATATGTCCGAAGG - Intergenic
1043903895 8:85799494-85799516 CTGGCTAGCCATATGTCCGAAGG - Intergenic
1043905507 8:85811688-85811710 CTGGCTAGCCATATGTCCGAAGG - Intergenic
1043907116 8:85823875-85823897 CTGGCTAGCCATATGTCCGAAGG - Intergenic
1044532061 8:93318413-93318435 CTGGTTAAACAGCTTTCCTAGGG + Intergenic
1044943295 8:97365569-97365591 CTGCCTGAAAAGATGTCCAAGGG + Intergenic
1047245478 8:123139742-123139764 CTGGAGAATCAGATGTCCACAGG - Intronic
1050447299 9:5739079-5739101 CTTGCAAAACAGATTTACAAGGG - Intronic
1051593127 9:18796564-18796586 GTTGCTAAACAGATATGCAAGGG - Intronic
1052434557 9:28409599-28409621 CTGGCTTAACAGATGTGCAGGGG + Intronic
1053329659 9:37191609-37191631 CTGGCTAATTAGAATTCCAAAGG + Intronic
1054851073 9:69847290-69847312 CTGCCTGAACAGCTGTCCAGAGG - Intronic
1059476798 9:114553858-114553880 CTGGCTAAACAGATGTCCAACGG - Intergenic
1186095202 X:6093164-6093186 CTGGCTATACAGATGTCAGTTGG - Intronic
1187056237 X:15743765-15743787 CTGGCCAAGCAGATGCCCAGGGG - Intronic
1190391096 X:49932525-49932547 GTGGCTAAGCAGTTGTCCAGGGG - Intronic
1190500367 X:51070433-51070455 GTGGCTTAACATATGTCCTATGG - Intergenic
1194088817 X:89561190-89561212 CTGGCAAAACAGATTTTGAAAGG - Intergenic
1200441490 Y:3217241-3217263 CTGGCAAAACAGATTTTGAAAGG - Intergenic