ID: 1059484911

View in Genome Browser
Species Human (GRCh38)
Location 9:114619270-114619292
Sequence ACGCGTGCACGCACGCGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059484911_1059484912 27 Left 1059484911 9:114619270-114619292 CCTCTGCGCGTGCGTGCACGCGT 0: 1
1: 0
2: 1
3: 6
4: 66
Right 1059484912 9:114619320-114619342 CAGACACACACATTTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059484911 Original CRISPR ACGCGTGCACGCACGCGCAG AGG (reversed) Intronic
900567655 1:3341565-3341587 ACGCGTGCGCACACACACAGAGG + Intronic
908023164 1:59919439-59919461 ACGTGTGCACGCATGCACAGTGG + Intronic
1076856952 10:133121883-133121905 ACACTTGCACGCACGCACACTGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085521819 11:77143588-77143610 ACATGTGCACGCATGCTCAGAGG - Intronic
1088920913 11:114259319-114259341 ACACGTGTACACACACGCAGAGG + Intronic
1090616912 11:128522810-128522832 GAGCGTGCAGGCAGGCGCAGGGG + Intronic
1091996613 12:4998688-4998710 ACACATGCACGCATGCACAGAGG - Intergenic
1094592445 12:31834334-31834356 ACATGTGCGCGCACGCACAGCGG - Intergenic
1095476259 12:42589856-42589878 ACGCGTGGGCGCGCGCCCAGCGG - Intronic
1111191801 13:84818397-84818419 ACACATGCACACACGCACAGAGG - Intergenic
1113755827 13:112809976-112809998 TCCCGTGCACGCACAGGCAGGGG - Intronic
1130766987 15:86880774-86880796 ACACGTGCACACACACACAGAGG - Intronic
1132543448 16:522018-522040 GCGCGCGCACACACACGCAGCGG - Exonic
1136129769 16:28212145-28212167 CCGCGTGGACGCACGGGCGGTGG - Intergenic
1141830533 16:86507888-86507910 ATGCGTGGGCGAACGCGCAGTGG + Intergenic
1142106397 16:88305560-88305582 ACACGTGCACACACGCTCACAGG + Intergenic
1145253675 17:21311053-21311075 ACACATGCACACACACGCAGTGG + Intronic
1145322911 17:21776908-21776930 ACACATGCACACACACGCAGTGG - Intergenic
1146102224 17:29994192-29994214 ACACGTGCACACACACGCGGTGG + Intronic
1158763704 18:60421974-60421996 ACGCGTGGAAGCACACGCGGAGG - Intergenic
1161227976 19:3156516-3156538 ACACATGCACGCACACGCACAGG + Intronic
1161353787 19:3808044-3808066 ACACATGCACGCACACGCACGGG - Intronic
1163314908 19:16535234-16535256 ATGGGTGCACGCACGTCCAGTGG + Intronic
1167466157 19:49651947-49651969 AGGCGGGAACGCAAGCGCAGCGG + Exonic
1168351030 19:55675497-55675519 ACGCGAGCCCGCGCGCGCCGCGG - Intronic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
936069146 2:109353772-109353794 ACGCATGCACACACGGGCAGGGG - Intronic
937395138 2:121528620-121528642 GCACGTGCATGCACGCGCACTGG + Intronic
948769861 2:240246137-240246159 ACACGTGCACACACACACAGAGG + Intergenic
1172587324 20:36093668-36093690 ACGCACGCACGCACGCACACGGG - Intronic
1174162539 20:48561939-48561961 GGGCGTGCACGCACACCCAGGGG - Intergenic
1178913799 21:36696123-36696145 CGGCTTGCTCGCACGCGCAGTGG + Intergenic
1180950308 22:19717928-19717950 ACGCACGCACGCACGCACGGGGG + Intronic
966982735 3:185153061-185153083 ACGCGCACACGCACGCGCACAGG + Intergenic
968778398 4:2559922-2559944 AAGCGTGCACAAAGGCGCAGAGG - Intronic
969706035 4:8792180-8792202 ACGCGTGCACGCACACACAGAGG + Intergenic
969706057 4:8792400-8792422 ACGCGTACACACACACACAGAGG + Intergenic
969706083 4:8792692-8792714 ACACGTGCACACACACACAGAGG + Intergenic
980340442 4:131538185-131538207 ACGTGTGCATGCACGTGCAATGG + Intergenic
980347988 4:131648459-131648481 ATGCGTGCACTCACACCCAGTGG + Intergenic
993384898 5:87252014-87252036 ACCCGTGCACACACCCGGAGGGG + Intergenic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
1003293945 6:4807031-4807053 ACCGGTGCACGCACGCACAGAGG - Intronic
1006137242 6:31902397-31902419 ACGGGTGCGCGCGCGCGCTGCGG - Intronic
1008648172 6:53537234-53537256 ACGCATGCACACACGTGCAAAGG + Intronic
1019601771 7:1887442-1887464 ACATGTGCACGCACACACAGAGG - Intronic
1019601837 7:1888379-1888401 ACGCATGCACACACACGCATAGG - Intronic
1023315750 7:38934601-38934623 ACGCGTGCACACACACACGGTGG + Intergenic
1030121285 7:106112583-106112605 ACGCGTACACGCGTGCGCAGGGG - Intergenic
1035501860 8:95729-95751 ACACGGGGACTCACGCGCAGAGG - Intergenic
1035891522 8:3348984-3349006 ACGGGTGCACACACACACAGAGG + Intronic
1036667352 8:10756081-10756103 ACCCGTGCATCCACGCACAGAGG + Intronic
1048882192 8:138880335-138880357 GCGCGTGCACACACACGCACAGG - Intronic
1049396488 8:142403329-142403351 ACTCGCGCGCGCACCCGCAGAGG - Intergenic
1052999770 9:34571533-34571555 ACGCGTGCACGCATGCACGTGGG - Intronic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1059484911 9:114619270-114619292 ACGCGTGCACGCACGCGCAGAGG - Intronic
1059532083 9:115044413-115044435 ACACAAGCACGCACGCGCATGGG + Intronic
1060544703 9:124453128-124453150 CCGCGTGTACTCACGTGCAGTGG + Exonic
1061882776 9:133576338-133576360 ACGCGTGCAGGCACACTCAGAGG - Intergenic
1203606491 Un_KI270748v1:61990-62012 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606534 Un_KI270748v1:62506-62528 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606562 Un_KI270748v1:62814-62836 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606582 Un_KI270748v1:63020-63042 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606592 Un_KI270748v1:63124-63146 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606728 Un_KI270748v1:64645-64667 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606776 Un_KI270748v1:65159-65181 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606815 Un_KI270748v1:65566-65588 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606897 Un_KI270748v1:66481-66503 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606958 Un_KI270748v1:67139-67161 ACACGGGGACTCACGCGCAGAGG + Intergenic
1203606997 Un_KI270748v1:67546-67568 ACACGGGGACTCACGCGCAGAGG + Intergenic
1187163920 X:16787157-16787179 TCGCCTGCCCGCCCGCGCAGTGG - Intronic
1192522292 X:71813524-71813546 ACGCATGCACGCACGCATATGGG - Intergenic