ID: 1059490914

View in Genome Browser
Species Human (GRCh38)
Location 9:114666684-114666706
Sequence AAACTTAAACCGCTACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059490914_1059490916 -1 Left 1059490914 9:114666684-114666706 CCTGGCAGTAGCGGTTTAAGTTT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1059490916 9:114666706-114666728 TCTCTTGTAAAAATTTCTTTGGG 0: 1
1: 0
2: 4
3: 67
4: 722
1059490914_1059490915 -2 Left 1059490914 9:114666684-114666706 CCTGGCAGTAGCGGTTTAAGTTT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1059490915 9:114666705-114666727 TTCTCTTGTAAAAATTTCTTTGG 0: 1
1: 0
2: 2
3: 61
4: 675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059490914 Original CRISPR AAACTTAAACCGCTACTGCC AGG (reversed) Intergenic
902459881 1:16566249-16566271 AAACCTAAACATCTACTGCAAGG + Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
920680935 1:208072294-208072316 AAACTAACACCCCCACTGCCTGG + Intronic
921182189 1:212640142-212640164 AAACTCAACCCTCTACTCCCAGG + Intergenic
1063266006 10:4451620-4451642 AAAATCAAATCGCTATTGCCAGG + Intergenic
1073633981 10:105178335-105178357 AAACTCAAAAAGCTACTGCCAGG + Intronic
1079947358 11:26760997-26761019 AGACTTAAACCTTTACTTCCTGG - Intergenic
1110420113 13:75298271-75298293 ATACTTAAACAACCACTGCCTGG - Intronic
1111021565 13:82458387-82458409 GATCTCAACCCGCTACTGCCGGG - Intergenic
1127871394 15:63076695-63076717 AAACAAAAGCCCCTACTGCCTGG - Intergenic
1131370774 15:91879804-91879826 AGAATTGAACCACTACTGCCTGG - Intronic
1142815244 17:2420105-2420127 ACACTTAAACAGGTACTGTCCGG + Exonic
1153608945 18:6862307-6862329 AAAAATAAACCTCTCCTGCCAGG + Intronic
1155469985 18:26181654-26181676 AAATTTAAAGTGCTACTGCAAGG + Intronic
1161582389 19:5087937-5087959 AGACTTAAACCTGTGCTGCCCGG - Intronic
1168268627 19:55237470-55237492 AAACTTAAACTGTGCCTGCCAGG + Intronic
1202676313 1_KI270711v1_random:9981-10003 AAACCTAAACATCTACTGCAAGG + Intergenic
925009159 2:468727-468749 AAAATTATTCCGCTAATGCCAGG + Intergenic
945941122 2:215951289-215951311 AAACTAACTCCGCTACTCCCTGG + Intronic
947598234 2:231427575-231427597 AAACTGCAACCTCCACTGCCTGG + Intergenic
1176361818 21:6003185-6003207 AAATTTAAAATGGTACTGCCAGG - Intergenic
1179761700 21:43535360-43535382 AAATTTAAAATGGTACTGCCAGG + Intronic
951562666 3:23983855-23983877 GAAATTAAACAGCTACTGCAGGG - Intergenic
955940374 3:64141550-64141572 AAAGTTAAAGCGCTTCTGCAAGG + Intronic
962537618 3:136344416-136344438 AGACTTTAATTGCTACTGCCTGG - Intronic
972498655 4:39657305-39657327 AAACTCAAACAACTATTGCCTGG + Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978843926 4:113249391-113249413 AAATTTAAAGCTCTACTCCCTGG - Intronic
979399438 4:120230398-120230420 AAACTTTAATCCCTACTTCCAGG - Intergenic
981973871 4:150699417-150699439 AAAGAAAAACAGCTACTGCCTGG + Intronic
991367383 5:65883405-65883427 AAACTGAAAATGCTACTCCCAGG - Intergenic
992073535 5:73170605-73170627 AAACTGGAACTGTTACTGCCAGG + Intergenic
992452013 5:76883881-76883903 ACACCTGAACCGCCACTGCCAGG - Intronic
994102377 5:95908011-95908033 AAACTGAAACCTCTACTGGCTGG + Intronic
1006842397 6:37037668-37037690 AAAATTAAATCACTACTGCGGGG - Intergenic
1008853842 6:56057304-56057326 AAACTCAAATCTCTACTGCATGG + Exonic
1009544437 6:65005791-65005813 GATCTTAACCGGCTACTGCCGGG - Intronic
1012750393 6:103155094-103155116 AAAGATAAACTGTTACTGCCAGG + Intergenic
1014247983 6:119087136-119087158 TAACCTTAACTGCTACTGCCTGG - Intronic
1017574271 6:155784281-155784303 AAACATAAATGGCTACTGCAAGG + Intergenic
1021864822 7:24944999-24945021 AAACCAAAACCGCCACTGCCAGG + Intronic
1037840399 8:22241019-22241041 AAACTAAAAAAGCTACTACCTGG + Intergenic
1038809288 8:30823477-30823499 AAACTCAAAATGCTCCTGCCTGG + Intergenic
1044281106 8:90357013-90357035 AAACTGAAGCCACTTCTGCCAGG + Intergenic
1047292355 8:123541394-123541416 AAACTTGAAGCGGTGCTGCCGGG + Intergenic
1049955753 9:691063-691085 AAATTTGAACCTCTTCTGCCTGG - Intronic
1053450010 9:38185574-38185596 AAACTTAAACCACTTCTGTTTGG - Intergenic
1055537288 9:77262205-77262227 AAAAATAAAACGCTTCTGCCTGG - Intronic
1059490914 9:114666684-114666706 AAACTTAAACCGCTACTGCCAGG - Intergenic
1192837679 X:74819345-74819367 AAACTTAAAGAGCTTCTGCACGG + Intronic
1198176515 X:134161028-134161050 GAACTAAAACCCCTACTGACTGG + Intergenic