ID: 1059491582

View in Genome Browser
Species Human (GRCh38)
Location 9:114672091-114672113
Sequence AAAGTAGCTCCTGTGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059491581_1059491582 11 Left 1059491581 9:114672057-114672079 CCTACTTTGCAGGAGTAAAGACT No data
Right 1059491582 9:114672091-114672113 AAAGTAGCTCCTGTGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059491582 Original CRISPR AAAGTAGCTCCTGTGAAGCT AGG Intergenic
No off target data available for this crispr