ID: 1059502407

View in Genome Browser
Species Human (GRCh38)
Location 9:114766505-114766527
Sequence CTAAGACTCTGACAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059502399_1059502407 27 Left 1059502399 9:114766455-114766477 CCGTGGACCTCCATTTGAGAACT No data
Right 1059502407 9:114766505-114766527 CTAAGACTCTGACAGGGGACAGG No data
1059502400_1059502407 20 Left 1059502400 9:114766462-114766484 CCTCCATTTGAGAACTGCTGCTC No data
Right 1059502407 9:114766505-114766527 CTAAGACTCTGACAGGGGACAGG No data
1059502401_1059502407 17 Left 1059502401 9:114766465-114766487 CCATTTGAGAACTGCTGCTCTAA No data
Right 1059502407 9:114766505-114766527 CTAAGACTCTGACAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059502407 Original CRISPR CTAAGACTCTGACAGGGGAC AGG Intergenic
No off target data available for this crispr