ID: 1059505847

View in Genome Browser
Species Human (GRCh38)
Location 9:114799291-114799313
Sequence CTGAGCCATCACAATAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059505847_1059505849 -4 Left 1059505847 9:114799291-114799313 CCAGGTCTATTGTGATGGCTCAG 0: 1
1: 0
2: 1
3: 11
4: 109
Right 1059505849 9:114799310-114799332 TCAGAAAGGCCACATATATAAGG No data
1059505847_1059505852 19 Left 1059505847 9:114799291-114799313 CCAGGTCTATTGTGATGGCTCAG 0: 1
1: 0
2: 1
3: 11
4: 109
Right 1059505852 9:114799333-114799355 TTCATTTTCCTCATTTCTTTGGG No data
1059505847_1059505851 18 Left 1059505847 9:114799291-114799313 CCAGGTCTATTGTGATGGCTCAG 0: 1
1: 0
2: 1
3: 11
4: 109
Right 1059505851 9:114799332-114799354 GTTCATTTTCCTCATTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059505847 Original CRISPR CTGAGCCATCACAATAGACC TGG (reversed) Intronic
900830442 1:4961501-4961523 ATGAGCCAGGACAACAGACCAGG + Intergenic
904282915 1:29433721-29433743 GTGAGCCATCCCAAGAGACTGGG - Intergenic
906287453 1:44596698-44596720 CTGACCCATCCCAAGGGACCTGG + Intronic
914214345 1:145611239-145611261 CTGAGCTCCCACAATATACCCGG - Intronic
914328227 1:146641735-146641757 CTGAGCCTTCAAAATAGCCATGG + Intergenic
916902176 1:169238779-169238801 CTGAGTCATCACAGTAGAACAGG + Intronic
1065770032 10:29069556-29069578 CTGTCCCATCACAACATACCAGG - Intergenic
1071300211 10:84250769-84250791 CTGAGGCAGCACAATGGTCCAGG + Intronic
1071387651 10:85138606-85138628 CTAGGCCATCACAGTAGACCAGG + Intergenic
1071921002 10:90350252-90350274 CTGAGCCATGACAATGAACATGG - Intergenic
1073650435 10:105352724-105352746 CTGAGCCATCACCTGTGACCAGG - Intergenic
1079497862 11:21066665-21066687 ATGAGCCACCACACTGGACCTGG - Intronic
1081147191 11:39577440-39577462 CTGAGCCAGCACACCAGGCCAGG - Intergenic
1085195646 11:74670123-74670145 CTGAGGCAGCACAATGGAGCTGG + Intergenic
1087569204 11:99903160-99903182 CAGAGCACTCACAATAGTCCTGG - Intronic
1095514272 12:42989064-42989086 CTGAAGCATCACTATTGACCTGG + Intergenic
1098999987 12:77168252-77168274 CTTGGTCATCACAATAGTCCAGG + Intergenic
1100921547 12:99494034-99494056 GTCAGCCATCACAATAGAGAAGG + Intronic
1102582230 12:113897094-113897116 CTGAGCCCTCCCAATAGACCCGG + Intronic
1104484421 12:129137842-129137864 CTGAGCAGCCACAATAGCCCTGG + Intronic
1108169219 13:47724024-47724046 CTGCACCCTCACAAGAGACCCGG - Intergenic
1115531213 14:34329166-34329188 TTGAGCCATCACAAAACACGTGG - Intronic
1116730333 14:48612984-48613006 GTGAGCCACCACAAAAGGCCTGG - Intergenic
1120351682 14:83368640-83368662 TTTAGCAATCACAATGGACCAGG - Intergenic
1124148750 15:27157765-27157787 GTGAGACATCACAACAGACAAGG + Intronic
1124859864 15:33428870-33428892 CTGAGATAACACAATATACCAGG + Intronic
1125344809 15:38708508-38708530 CTTAGCCATCACAAAAGACTTGG - Intergenic
1128357565 15:66938827-66938849 CTGAGCCACCACATCAGCCCTGG + Intergenic
1128366982 15:67011366-67011388 CTGACCAATCAGAATAGACCTGG + Intergenic
1132371170 15:101300183-101300205 CTGAGCCATCACACCTGCCCCGG + Intronic
1133439851 16:5811729-5811751 GTGAGCCACCACACTAGGCCAGG + Intergenic
1135024629 16:18989591-18989613 CTGAGCGATCACCACATACCAGG + Intronic
1135315444 16:21440966-21440988 CTGAGCGATCACCACATACCAGG - Intronic
1135368370 16:21873234-21873256 CTGAGCGATCACCACATACCAGG - Intronic
1135443447 16:22497915-22497937 CTGAGCGATCACCACATACCAGG + Intronic
1135449246 16:22543380-22543402 CTGAGCGATCACCACATACCGGG + Intergenic
1135733980 16:24916216-24916238 CAGGGCCATCACAATGGTCCAGG + Intergenic
1136312114 16:29419625-29419647 CTGAGCGATCACCACATACCAGG - Intergenic
1136325553 16:29521422-29521444 CTGAGCGATCACCACATACCAGG - Intergenic
1136440242 16:30261404-30261426 CTGAGCGATCACCACATACCAGG - Intergenic
1137717235 16:50605417-50605439 CTGAATCATCACAACAGCCCTGG - Intronic
1139886739 16:70213686-70213708 CTGAGCGATCACCACATACCAGG - Intergenic
1140005335 16:71069206-71069228 CTGAGCCTTCAAAATAGTCATGG - Intronic
1141326221 16:83061879-83061901 CTGAGATGTCACAATAGTCCAGG + Intronic
1142209101 16:88799490-88799512 CTGAGCCACCATAATTGACATGG + Intergenic
1142485646 17:246218-246240 TGGACCCATCACAATAGACCTGG - Intronic
1146533570 17:33630768-33630790 CTGAGCATACACCATAGACCAGG - Intronic
1150651933 17:67016120-67016142 CTGAGCCACCACCATGGGCCCGG + Intronic
1153223718 18:2882413-2882435 CTGAGCCATCAGAATCACCCAGG - Intronic
1154317345 18:13315150-13315172 TTTAGCCTTCACAAAAGACCGGG + Intronic
1155212521 18:23614342-23614364 GTGAGCCACCACACCAGACCAGG + Intronic
1156371968 18:36479340-36479362 CTGTGTCATCATAATAAACCCGG + Intronic
1160084664 18:75765078-75765100 CTGTGGCATCACAAAATACCTGG + Intergenic
1163560317 19:18015379-18015401 GTGAACCATCACAACCGACCTGG + Intergenic
1166262382 19:41649624-41649646 CTGAGCCATCCCCAGAGATCAGG - Intronic
927697739 2:25249554-25249576 CTGAGCAGGCACTATAGACCAGG + Intronic
929391649 2:41475296-41475318 CTGAGCACTTACAATAGACTTGG - Intergenic
931837537 2:66114526-66114548 CTGAGCCCTCACTATGGATCAGG - Intergenic
932972812 2:76566672-76566694 CAGAGCCATCACAATAAAGATGG - Intergenic
935612745 2:105042783-105042805 CTGAGCAATTATTATAGACCAGG - Intronic
937793208 2:125984416-125984438 CTGAGCAAGCACAATATGCCAGG + Intergenic
943986115 2:194621258-194621280 ATAAGCTATCACTATAGACCTGG - Intergenic
944799171 2:203220201-203220223 GTGAGCCACCACAATTGGCCAGG - Intronic
946140255 2:217684264-217684286 CTGAGCCACCACAGGAGAACAGG + Intronic
1173046974 20:39521738-39521760 CTGAGCCATCACAGTAAACAAGG - Intergenic
1182108230 22:27704451-27704473 CTGAGCCATGAGAATTGCCCGGG + Intergenic
1185175782 22:49325710-49325732 CAGGGCCATCACGATAGACGTGG - Intergenic
955139340 3:56253760-56253782 TAGAGCCACCACAACAGACCTGG - Intronic
955506129 3:59634974-59634996 CTGAGCCATCACAGGGAACCTGG + Intergenic
955717676 3:61847519-61847541 CTGAGCCCTCAAAATACAGCCGG - Intronic
962344587 3:134610016-134610038 CTGGGCCCTCACAATTGGCCTGG + Intronic
962395584 3:135013018-135013040 CTGAGACATCATAATAGATGTGG + Intronic
965324457 3:167285854-167285876 CTGAGCACTTACAATAGGCCAGG + Intronic
969518669 4:7662870-7662892 TGGAGCCAACACAACAGACCAGG - Intronic
973649398 4:52983098-52983120 CAGTGCCTTCACAATAGACCTGG + Intronic
974351120 4:60747667-60747689 CTCAGACATCACAATATACAAGG + Intergenic
975838048 4:78444901-78444923 CTGGAGCATCACAATAGCCCTGG + Intronic
980163523 4:129196686-129196708 TTGAGCCATCACACTTGGCCTGG + Intergenic
982111648 4:152062026-152062048 CAGAGCCATCACAAGAGGCCTGG - Intergenic
982164419 4:152602144-152602166 GTGATCCAACACAATAAACCTGG - Intergenic
982594489 4:157362004-157362026 CTGTGCCATCAAAACAGACAAGG - Intronic
985495383 5:201688-201710 CGAAGGCATCACAATTGACCTGG - Exonic
992759865 5:79942041-79942063 CTGAGCCATGACAAGATGCCTGG + Intergenic
999346952 5:150831826-150831848 CTGAACCAGCACATTACACCAGG + Intergenic
1000842397 5:166236833-166236855 CTTAGACAACACAATAAACCAGG + Intergenic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1006751273 6:36379257-36379279 CTCAGCCACCACAACAGGCCAGG - Intronic
1007381978 6:41496037-41496059 TTGAGCCATTACAATATATCAGG - Intergenic
1011162838 6:84411252-84411274 ATTAGCCCACACAATAGACCAGG + Intergenic
1011683237 6:89803102-89803124 CTTGGCCATCAGAACAGACCTGG - Intronic
1013317577 6:108957105-108957127 CTGACCCATCACAGGAGAGCAGG - Intronic
1017024890 6:150173000-150173022 ATGAGCCACCCAAATAGACCTGG + Intronic
1017202477 6:151770823-151770845 CTAATCTATCACATTAGACCTGG + Intronic
1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG + Intergenic
1022856198 7:34317055-34317077 CGGAGCCATCATATCAGACCAGG - Intergenic
1022916640 7:34962547-34962569 GTGAGCCACCACAATCGGCCTGG - Intronic
1023747247 7:43332789-43332811 TTGAGCCATCCCAATGTACCTGG + Intronic
1024434066 7:49328282-49328304 ATAAGCTATCACTATAGACCTGG + Intergenic
1024824582 7:53376924-53376946 ATGAGCCATCACAACAGCCCAGG + Intergenic
1028724150 7:94068491-94068513 CAGAGGCCTCACAATATACCTGG - Intergenic
1032077917 7:128844792-128844814 ATGAGCCATCACCATTGTCCTGG - Exonic
1034531416 7:151698258-151698280 CTGAGGCCTCACAAGGGACCTGG - Intronic
1034592602 7:152155068-152155090 CTGAGACCTCACAATTGGCCTGG - Intronic
1034854124 7:154524598-154524620 CTGGGCCAGGACACTAGACCAGG + Intronic
1038449666 8:27631949-27631971 CTGTGGCATCAGAAGAGACCAGG + Intergenic
1042733414 8:71962045-71962067 CTGAGCCATCAAAATTACCCAGG - Intronic
1045039513 8:98208729-98208751 GTGAGCCATCACACCAGGCCTGG + Intronic
1047039651 8:120978834-120978856 CTTAACCCTCACAATAGTCCTGG - Intergenic
1051279808 9:15431064-15431086 CTGAGCCAGCACATCAGATCAGG - Intronic
1052717984 9:32141173-32141195 CTGAGCCTTCACAATTTACAGGG + Intergenic
1059172566 9:112139941-112139963 ATGAGCCACCACACTTGACCTGG - Intronic
1059505847 9:114799291-114799313 CTGAGCCATCACAATAGACCTGG - Intronic
1061363074 9:130156074-130156096 TTGAGGCATCAGAATTGACCAGG - Intergenic
1062217237 9:135395850-135395872 CTTGGCCATCACCATAGCCCTGG + Intergenic
1062218442 9:135401720-135401742 CTGAGCCATCACACTCCACATGG + Intergenic
1186907112 X:14123028-14123050 CTGAGCCATCACACCAGTCCTGG + Intergenic
1190437490 X:50440205-50440227 CTGAGGCATCACCATTCACCTGG + Intronic
1192916282 X:75654634-75654656 CAGAGAGAACACAATAGACCTGG - Intergenic
1193373709 X:80732016-80732038 GTGACCCATCACAAGAGGCCAGG - Intronic
1194803180 X:98296205-98296227 CTGAACCTTCACCATGGACCAGG - Intergenic
1199003988 X:142674391-142674413 ATGAGCCACCACACTAGGCCGGG + Intergenic
1199680867 X:150223741-150223763 CTGAGCCCTCATAATAGAGCTGG - Intergenic