ID: 1059510323

View in Genome Browser
Species Human (GRCh38)
Location 9:114839365-114839387
Sequence TTCTGTCTCTGCTAACTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059510323_1059510331 14 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510331 9:114839402-114839424 GAGGCCAGAGGGTTTGGCATGGG No data
1059510323_1059510333 19 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510333 9:114839407-114839429 CAGAGGGTTTGGCATGGGAACGG No data
1059510323_1059510325 -5 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510325 9:114839383-114839405 CAGAACTCCTGTCTGTGTGGAGG No data
1059510323_1059510334 28 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510334 9:114839416-114839438 TGGCATGGGAACGGCTGCAGTGG No data
1059510323_1059510328 3 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG No data
1059510323_1059510324 -8 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510324 9:114839380-114839402 AGACAGAACTCCTGTCTGTGTGG No data
1059510323_1059510327 2 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510327 9:114839390-114839412 CCTGTCTGTGTGGAGGCCAGAGG No data
1059510323_1059510330 13 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510330 9:114839401-114839423 GGAGGCCAGAGGGTTTGGCATGG No data
1059510323_1059510329 8 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510329 9:114839396-114839418 TGTGTGGAGGCCAGAGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059510323 Original CRISPR TTCTGTCTCTGCTAACTCTC TGG (reversed) Intergenic
No off target data available for this crispr