ID: 1059510328

View in Genome Browser
Species Human (GRCh38)
Location 9:114839391-114839413
Sequence CTGTCTGTGTGGAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059510323_1059510328 3 Left 1059510323 9:114839365-114839387 CCAGAGAGTTAGCAGAGACAGAA No data
Right 1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059510328 Original CRISPR CTGTCTGTGTGGAGGCCAGA GGG Intergenic
No off target data available for this crispr