ID: 1059516786

View in Genome Browser
Species Human (GRCh38)
Location 9:114903286-114903308
Sequence GTCCCAGCCTGGTTTTCCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059516777_1059516786 29 Left 1059516777 9:114903234-114903256 CCATTGTGGTGGTGTATTAAATT 0: 1
1: 1
2: 0
3: 27
4: 221
Right 1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG 0: 1
1: 1
2: 3
3: 20
4: 201
1059516783_1059516786 -2 Left 1059516783 9:114903265-114903287 CCATCTCAGGAACAGGGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG 0: 1
1: 1
2: 3
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059516786 Original CRISPR GTCCCAGCCTGGTTTTCCCT GGG Exonic
900350216 1:2230845-2230867 GCTCCAGCCCGGTTTTCTCTGGG + Intronic
901455481 1:9360638-9360660 GTCCCAGCCTCTGTTTCCCCAGG + Intronic
901628732 1:10638285-10638307 GACGCAGCCTCGGTTTCCCTGGG + Exonic
901811425 1:11768901-11768923 GCCCCTGCCTGGTGTTCCCTTGG + Intronic
903211515 1:21821892-21821914 GTCCCAGCCAGGTCTCCCCAGGG + Intronic
903554279 1:24181714-24181736 GCCCAGGCCTGGTTTTCCCTGGG + Intronic
907647537 1:56259220-56259242 GTCTCAGCCTGCTTTTTCTTAGG - Intergenic
908003852 1:59708423-59708445 GGCCGAGCCTGGTATTCCCCTGG - Intronic
908248693 1:62248099-62248121 GCCCCAGCCTGACTTTCCCCAGG + Intronic
908354257 1:63316301-63316323 GTTCCAGCCCAGTCTTCCCTTGG - Intergenic
915519798 1:156435552-156435574 GTTCCAGCCTGGTTTTGGCCTGG - Intergenic
915951852 1:160194929-160194951 TCCCCAGCCTTCTTTTCCCTAGG + Intronic
916734548 1:167596376-167596398 ATCCAAGTCTGGTTTTCTCTTGG + Intergenic
919168637 1:193927103-193927125 CTCCAAGCCTGGCTTGCCCTTGG - Intergenic
921494219 1:215817609-215817631 GTCCCATCATGGTGTTCCCGTGG - Intronic
922029502 1:221784224-221784246 AAGCCAGGCTGGTTTTCCCTTGG + Intergenic
923868757 1:237968112-237968134 GTCCCAGCTTGACTTTCCCTTGG + Intergenic
924888632 1:248248584-248248606 GTCCCTGCCTGGGTTTCCTCGGG - Intergenic
1063094939 10:2900740-2900762 TTCCCAGCATGGTCTTCCCGGGG - Intergenic
1064656073 10:17557581-17557603 GTCCCCCACTGGTTTTGCCTGGG + Intergenic
1067052758 10:43032166-43032188 GTCTCACCCTAGTTTTCCTTGGG - Intergenic
1067753417 10:48986378-48986400 GCTCCAGCCTGGTTAACCCTGGG - Intergenic
1069584541 10:69589329-69589351 TTCCCAGCCTGGTCCTCACTGGG - Intergenic
1070940270 10:80338373-80338395 GGCCTAGCCTCATTTTCCCTAGG + Intronic
1072168638 10:92838749-92838771 GTCCCAGCATGGTTTAGCTTTGG + Intronic
1072223673 10:93348608-93348630 GTCCCAAAGTGGTTGTCCCTGGG - Intronic
1073050456 10:100663656-100663678 GTCCCAGCCTGGTGATTACTGGG - Intergenic
1074038389 10:109763704-109763726 GTCACAGGCTGGGTTTCCCCAGG + Intergenic
1075211008 10:120491054-120491076 GTCCCAGACTGCTTTCCCATTGG + Intronic
1075712023 10:124535978-124536000 GTCCCAGGCAGGATTCCCCTGGG + Intronic
1076696713 10:132250749-132250771 GTCTCCGCCTGGCTTTCCATCGG + Intronic
1076713302 10:132350889-132350911 TCTCCAGCCTGGTTTTCCCCAGG + Intronic
1077189373 11:1249411-1249433 GGCCCAGCCTGGTGTCCCCCTGG + Exonic
1077271154 11:1682132-1682154 GTCCCAGCCTGTGTTTCCCTGGG - Intergenic
1077511166 11:2963893-2963915 ATCCCAGCCTGGTTCTCCCAGGG - Intronic
1079871671 11:25806052-25806074 GTCCCAACCATGTTTTCCCAGGG - Intergenic
1083347441 11:62003413-62003435 TTTCCAGCCTGGGGTTCCCTGGG - Intergenic
1083707422 11:64525982-64526004 GTCCCAGGCTGGGTCTCCCAGGG + Intergenic
1084363926 11:68685595-68685617 GGTCCAGCCTCGTTTTTCCTTGG - Exonic
1084696919 11:70761282-70761304 GTCCCAGTCTTTTTCTCCCTTGG + Intronic
1084711698 11:70847744-70847766 GAACCAGCCTGGCTTTGCCTGGG + Intronic
1084770092 11:71337027-71337049 GTCTCAGCCTCCTTTTCCCATGG - Intergenic
1084954011 11:72681870-72681892 GTCCCCGACTGCTCTTCCCTAGG + Intergenic
1088753284 11:112864200-112864222 GTCTCTGCCTAGTCTTCCCTTGG + Intergenic
1090601144 11:128372818-128372840 AACCCAGCTTGGTTTTCACTAGG + Intergenic
1090602509 11:128387773-128387795 GTCCCAGCTTGTTATACCCTGGG + Intergenic
1090636841 11:128694734-128694756 GTCCCTGCCTGGTGGGCCCTGGG + Intronic
1090726405 11:129530889-129530911 GCCCCAGCCTCCTTTCCCCTTGG - Intergenic
1095406988 12:41877754-41877776 TTCCCAGGCTGGTGTTCCCTGGG - Intergenic
1096534630 12:52263495-52263517 GTCCCAACCTGGCTTCCCCCTGG + Intronic
1101807133 12:108073846-108073868 CTCCCTGCCTGGTTTACCTTGGG + Intergenic
1102471043 12:113160099-113160121 TTCTCAGCCTGTTTTTACCTAGG - Intronic
1103289881 12:119836459-119836481 ATCCCAACCTGGTTCTCCATAGG + Intronic
1104879753 12:132062319-132062341 CTCCCAGCCTGGCTTTACCTTGG - Exonic
1106400092 13:29421553-29421575 GTCCCATCCTGCATTGCCCTAGG + Intronic
1109177263 13:59171840-59171862 GTATCAGCCTGTTCTTCCCTTGG - Intergenic
1109182550 13:59231315-59231337 CTCCCAGCTTTGTTTTCCATAGG + Intergenic
1109818269 13:67617121-67617143 GTCCCAGAATCGTTTCCCCTTGG + Intergenic
1109944787 13:69419846-69419868 CTCCATGCCTGGTTTGCCCTTGG - Intergenic
1110343044 13:74414649-74414671 ATCCGAGCCTGGCTTGCCCTTGG + Intergenic
1113872260 13:113566473-113566495 GGCCCAGCCTGGTGTTGCCACGG + Intergenic
1113897787 13:113776758-113776780 TTCCTACCTTGGTTTTCCCTTGG + Intronic
1117463774 14:55972396-55972418 GCCCCAGCCTGATTTTCCCTGGG + Intergenic
1117882292 14:60323819-60323841 CAGCCAGCCTGGTGTTCCCTGGG + Intergenic
1119318342 14:73714064-73714086 GTCGCAGCCTGGTCTTCCCGCGG + Exonic
1120568757 14:86091992-86092014 GACTCATCCTGGTTTTCCCAGGG + Intergenic
1122125363 14:99575816-99575838 CTTCCAGCCTGGGTGTCCCTGGG - Intronic
1125250442 15:37696067-37696089 TTGCCAGCCTTGGTTTCCCTGGG - Intergenic
1129460353 15:75697288-75697310 GCCCCATCCTGGCTGTCCCTGGG + Intronic
1130437186 15:83913070-83913092 GTGGCTTCCTGGTTTTCCCTAGG + Exonic
1131970297 15:97885343-97885365 ATCCCAGCCTGGATTTTTCTAGG - Intergenic
1132749218 16:1449659-1449681 GGCCCAGCCTGATGTTCCCGGGG - Intronic
1132827816 16:1913780-1913802 GGCCCAGCCTGCGTTTCCCTGGG - Intronic
1132829129 16:1918879-1918901 GTCCCGGCCTCTTTCTCCCTTGG - Intergenic
1133598996 16:7320903-7320925 ATCCCTGGCTGTTTTTCCCTGGG - Intronic
1137696484 16:50465371-50465393 GACCAAGCATGGTTTTCCCTTGG + Intergenic
1140700270 16:77575073-77575095 GTCCCCTCCAGGATTTCCCTGGG - Intergenic
1140934993 16:79662182-79662204 ATGCCAGCCTGGCTTTCCTTGGG - Intergenic
1141643893 16:85357233-85357255 GGTCCAGCCTGGTGTTCCCTAGG + Intergenic
1142684200 17:1568202-1568224 TTCTCAGCATGGTTTCCCCTGGG + Intergenic
1143309828 17:5979005-5979027 ACCCCAGCCTGGTGTTCTCTTGG - Intronic
1144515177 17:15912470-15912492 ATCCCAGCCTTTTTCTCCCTAGG + Intergenic
1145961419 17:28888491-28888513 GTCCCTGCCTGGATTACCCCAGG + Intronic
1146315358 17:31802681-31802703 GCCACAGCCTGTTTCTCCCTGGG + Intergenic
1146762775 17:35492724-35492746 GTCCAAGAATGGCTTTCCCTCGG + Intronic
1147760637 17:42795487-42795509 GCGCCAGCCTGGCTTCCCCTGGG - Exonic
1151254254 17:72863399-72863421 GTCCCTCCTTGGGTTTCCCTTGG - Intronic
1152637985 17:81437971-81437993 GTCCGGGCCTGGTTCTCCTTTGG + Intronic
1154145281 18:11861593-11861615 GTGCCAGCCTGGCTTTACCAAGG - Intronic
1154321125 18:13353748-13353770 TTCCCAGCCTGGTGTAGCCTTGG - Intronic
1157546299 18:48548999-48549021 GTCCCAGCATGATTATCCATTGG - Intronic
1158869184 18:61667744-61667766 GACACAGACTTGTTTTCCCTTGG - Intergenic
1159134944 18:64326523-64326545 TTTCCAGCCTGATTTTCCCTGGG + Intergenic
1160817926 19:1044805-1044827 TTCCCACCCTGGTGTTCCCAGGG + Intronic
1161026719 19:2040372-2040394 GGCCCAGCCTCGGGTTCCCTGGG - Intronic
1161661057 19:5546575-5546597 GTCCCAGCCTGGGGATCCTTGGG - Intergenic
1161953499 19:7480387-7480409 GGCCCAGCCTGGATGTTCCTGGG - Intronic
1164759568 19:30718906-30718928 GTCCCAGCCCAGTTTCCACTGGG - Intergenic
1165106302 19:33471564-33471586 GTCCCAGCCTTGTCTGCCCCAGG + Intronic
1165772289 19:38386645-38386667 GGCCCAGCCTGGCTTTCTGTCGG + Exonic
1166916111 19:46196957-46196979 GTCCCAGCCTGGGATCTCCTGGG - Intergenic
1166924896 19:46260735-46260757 GTCCCAGCCGGGGGTCCCCTGGG + Intergenic
1167318920 19:48783489-48783511 GCCCCATCCACGTTTTCCCTTGG - Intergenic
1168224126 19:54982346-54982368 GGGCCAGCGTGGTTTTCCCAAGG - Exonic
1168444634 19:56401332-56401354 TTCCCAGCTTGACTTTCCCTTGG - Intronic
925002624 2:418025-418047 GTCCCACCCAGATTCTCCCTAGG + Intergenic
926208819 2:10853740-10853762 GCCCAAGACTGCTTTTCCCTGGG - Intronic
926558423 2:14387896-14387918 GTCCCAAACTGGTTTTCTCCTGG - Intergenic
927823609 2:26291265-26291287 GTCCCAGCATCGTTTCCCCATGG + Intergenic
928253895 2:29705478-29705500 GTTCTAGCCTGCTTCTCCCTGGG - Intronic
928300387 2:30119007-30119029 TTCCCAGCCTCAATTTCCCTAGG - Intergenic
930866854 2:56130479-56130501 CTCCCAGGTTGGGTTTCCCTGGG - Intergenic
933617102 2:84493748-84493770 GTCCCAGCCTAGCTTCCTCTTGG - Intergenic
935364910 2:102279052-102279074 CTCCCAGCCTTGTTTTCCAATGG + Intergenic
937265455 2:120612272-120612294 TTCCCAGCCCGCTTTTCCCCAGG + Intergenic
937516395 2:122660811-122660833 ACCGCAGCCTGGGTTTCCCTTGG - Intergenic
938565727 2:132516661-132516683 GACCCAGCTTGGCTTTACCTAGG - Intronic
938580231 2:132639115-132639137 GCCCCAGCCTGGTTTTCTAAGGG - Intronic
938883712 2:135620203-135620225 CTCCCAGCCTGGATTTCACTGGG + Intronic
940190707 2:151037367-151037389 GTCTCAGCCTTATTTTACCTAGG - Intronic
940641134 2:156345567-156345589 GTCCTAGACTTGTTTGCCCTCGG + Intergenic
942493205 2:176510645-176510667 GGCCCAACTTGGTTTTCTCTGGG + Intergenic
944620009 2:201504770-201504792 TTCCATGCCAGGTTTTCCCTGGG + Intronic
947186706 2:227461877-227461899 GTCCAAGCCTGGATCTCCCCTGG - Intergenic
948590574 2:239047184-239047206 GTCCCTGTCTCGTCTTCCCTGGG - Intergenic
949052815 2:241906147-241906169 GTCCCAGCCTGGCCCACCCTGGG - Intergenic
1169853953 20:10083178-10083200 ATAGCAGCCTGATTTTCCCTTGG - Intergenic
1169880631 20:10342405-10342427 GTCCATGCCTGGCTTGCCCTTGG + Intergenic
1169938965 20:10916507-10916529 GTCCCAGCCATGTTTTCCCATGG - Intergenic
1170500966 20:16974930-16974952 GTCCCACCTTGGCTTTCCCCCGG - Intergenic
1170753178 20:19170841-19170863 GTCTTCACCTGGTTTTCCCTAGG - Intergenic
1174579561 20:51562300-51562322 GTCCCAGGCCGGGATTCCCTAGG - Intronic
1174719091 20:52791796-52791818 TTCACATACTGGTTTTCCCTTGG + Intergenic
1175334549 20:58186655-58186677 TACCCAGCTTTGTTTTCCCTGGG - Intergenic
1175801191 20:61801846-61801868 GGCCCATCCTGGATTTCCCAGGG - Intronic
1176055062 20:63140994-63141016 GTCCCAGCCTGGTGCATCCTGGG - Intergenic
1178512477 21:33217170-33217192 TTCCCAGCTTGACTTTCCCTTGG + Intergenic
1178531960 21:33383199-33383221 GACTCATCCTGGTTTACCCTGGG + Intergenic
1179465130 21:41567040-41567062 GTCCCAGACTTGGCTTCCCTAGG + Intergenic
1181461210 22:23086912-23086934 GTCCCATCATGGGTTTCCCAGGG - Intronic
1181682305 22:24503910-24503932 GCCCCAGGCTGGGTTTTCCTTGG + Intronic
1181892661 22:26077481-26077503 CTCCCAGCCTTGGTTTCCCTAGG - Intergenic
1183980087 22:41534233-41534255 GTTCCAGCCTGGGGCTCCCTGGG - Intronic
1185081856 22:48713917-48713939 GTCCTAGCCTGTTCTTCCCATGG - Intronic
1185098956 22:48827397-48827419 GAGCCAGCCTGGTTCTCGCTGGG - Intronic
950147633 3:10663360-10663382 GTCCCTGGCTGGTGTCCCCTGGG - Intronic
951465415 3:22995958-22995980 GTCGCTTCCTTGTTTTCCCTTGG - Intergenic
955446437 3:59015942-59015964 GTCCCAGCCTGGGCATCCATTGG - Intronic
957458434 3:80484747-80484769 GTCAGAGCCTGGTTTACCTTGGG + Intergenic
961650198 3:128413369-128413391 ATCCCAGCCTTGTGCTCCCTGGG + Intergenic
963460681 3:145611125-145611147 TTCACAGACTGGTTTTCTCTGGG + Intergenic
965516770 3:169630002-169630024 GTCCCAGCCTGCTCCTCCATTGG + Intronic
966052539 3:175638423-175638445 GTGGCAGCATGGTTGTCCCTAGG - Intronic
968703303 4:2066780-2066802 GGCCCGGCCTGGCTTTCCCCGGG - Exonic
969527535 4:7711524-7711546 GGCCCAGCCTGCTCTTCCCTGGG - Intronic
971215486 4:24658484-24658506 GTTTCAACCTTGTTTTCCCTTGG - Intergenic
973259709 4:48150379-48150401 GTCTCAGCCTGGATATCACTTGG + Intronic
973319428 4:48794955-48794977 GTCCCAGCCTCTGCTTCCCTGGG + Intergenic
974615228 4:64271681-64271703 GTCCCAGTCTGGTTGTGTCTGGG - Intergenic
974730678 4:65861390-65861412 TTCCCAGCCTTGTTTTCAGTTGG + Intergenic
980179480 4:129386507-129386529 GTGCCATGATGGTTTTCCCTAGG - Intergenic
984731618 4:183073773-183073795 TTCCCATCCGGGTTTTACCTGGG - Intergenic
985286770 4:188344280-188344302 CACCCAGCCTCCTTTTCCCTGGG + Intergenic
985477378 5:85753-85775 GGGCCAGCCTGTTTTTCTCTGGG - Intergenic
990116129 5:52393822-52393844 GTCCCAGACTCTGTTTCCCTGGG - Intergenic
990780759 5:59359875-59359897 TTCCGAATCTGGTTTTCCCTAGG - Intronic
992845159 5:80739434-80739456 AACCCAACCTGGTTTTCCCTAGG + Intronic
996862468 5:128082941-128082963 TCCCCAGCCTGGTTTGCTCTGGG - Intergenic
999491339 5:152054443-152054465 TTCCCAGTCTGCTTTTCCTTGGG + Intergenic
1002081420 5:176739847-176739869 GGCCCAGCCTGTGTTTACCTCGG + Intergenic
1002693943 5:181071481-181071503 GTGCCAGCCTGTGTTTCCCTTGG - Intergenic
1002761929 6:209159-209181 CTCCCAGCATAGTTTACCCTGGG - Intergenic
1004262441 6:14119695-14119717 GTCCCTGCCTGGTTAGCCCAGGG - Intronic
1004934263 6:20491916-20491938 GTCCAAGAATGGCTTTCCCTCGG + Exonic
1013420026 6:109959153-109959175 GTCCCAGCCTAGGCTACCCTTGG + Intergenic
1013684301 6:112561336-112561358 GCCCCAGCCTGGTTCTCCTGAGG + Intergenic
1015383379 6:132594784-132594806 TTCCCACCGTGGTTGTCCCTGGG + Intergenic
1015785223 6:136916327-136916349 CTCTCAGCCTGGATCTCCCTGGG - Intergenic
1017989983 6:159478250-159478272 GGCCCACCCAGGTTTTCCATTGG + Intergenic
1019702011 7:2478595-2478617 GGGCCAGCCTGCTTCTCCCTGGG - Intergenic
1021044537 7:15906556-15906578 GGCCCTGCCTGGTTCTCACTAGG + Intergenic
1021176881 7:17459613-17459635 GACCCAGCCTGGTGTGTCCTGGG - Intergenic
1022302612 7:29115282-29115304 GGCTCAGCCTGGTTCTCCCAGGG + Intronic
1022464908 7:30647077-30647099 GTTCCAGTCTGGTGTTCTCTGGG - Intergenic
1024574238 7:50751099-50751121 GTCCCAGCCTCGACTTGCCTTGG + Intronic
1026232074 7:68493656-68493678 TTCCCATCCTGCTTTCCCCTAGG + Intergenic
1029435166 7:100559995-100560017 CTCCCAGCCTGGTCCTCACTGGG + Intronic
1032099559 7:128962414-128962436 GTCCAAGCCTGCTTTTCACATGG - Intronic
1032107103 7:129041595-129041617 GTCCAAGCCTGGATTTCAGTGGG - Intronic
1034359145 7:150478711-150478733 GCCCCAGCCTGCTTATTCCTCGG - Exonic
1034449918 7:151131812-151131834 GTCCCAGCCTGGGCATCCCAGGG + Intronic
1035883717 8:3269423-3269445 GTCCCAGCCTGTTCTGCCATGGG + Intronic
1036132533 8:6129036-6129058 GACACAGGCTGCTTTTCCCTGGG - Intergenic
1037521151 8:19681742-19681764 GGCCCAGCCTGGCATTCCCAGGG - Intronic
1037525364 8:19719185-19719207 TTCCCATCCTTGTTTTCTCTTGG + Intronic
1037603760 8:20420615-20420637 GTCCCAGGGTTGTTATCCCTGGG - Intergenic
1041450967 8:58006510-58006532 GACCCAGCCAGTTTTACCCTAGG - Intronic
1042062945 8:64840828-64840850 GTCTCAGCCTGGTCTTCAATTGG + Intergenic
1042531531 8:69820908-69820930 CTCCCAGCCTGTTTCTGCCTGGG - Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1046249506 8:111611760-111611782 CTCCCCGCCTGGCTTGCCCTCGG - Intergenic
1047774242 8:128056515-128056537 GTCCCAGGCTGCTTTAACCTGGG + Intergenic
1049309226 8:141924510-141924532 GGTCCAGCCTGATTTCCCCTTGG + Intergenic
1049556107 8:143283048-143283070 TTCACAGCCTGCTCTTCCCTGGG + Intergenic
1050589527 9:7147983-7148005 CTCCAAGCCTGGCTTGCCCTTGG - Intergenic
1053041427 9:34876832-34876854 GTCCCTGCTTTGTTTTCCTTTGG - Intergenic
1053278694 9:36802378-36802400 GCCCCAGGCTGGTTCTCCCCGGG - Intergenic
1053303474 9:36968157-36968179 GACCCACGCTGGTTTTCCCCAGG - Intronic
1056518117 9:87374087-87374109 GTCCCAGCCTGCTCATCCCTGGG + Intergenic
1057207474 9:93182364-93182386 GTCCCATCCTGGTTTTCCCTTGG + Intergenic
1057969683 9:99542443-99542465 GTCTCAGCATGGCTTTCCCTGGG + Intergenic
1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG + Exonic
1061042059 9:128146037-128146059 GTCCCTGCCTGGGTTTTCCGTGG - Intergenic
1061500504 9:130998790-130998812 GTCCCGGCCTGGTGTCCCCGTGG - Intergenic
1061629968 9:131866125-131866147 TCCCCAGCCTGCTGTTCCCTGGG + Intronic
1062054550 9:134464048-134464070 GTCCCAGACTGGCTTCCCCAAGG - Intergenic
1062123014 9:134844051-134844073 GGCCCAGCCTGCATTTCCCATGG - Exonic
1185863680 X:3603481-3603503 GTCCCATCTTGGAATTCCCTGGG - Intergenic
1185893199 X:3837984-3838006 GTCACCGCCTCGTGTTCCCTTGG - Intronic
1185898311 X:3876406-3876428 GTCACCGCCTCGTGTTCCCTTGG - Intergenic
1185903426 X:3914835-3914857 GTCACCGCCTCGTGTTCCCTTGG - Intergenic
1189479506 X:41381841-41381863 GCCACTGCCTGGTGTTCCCTCGG + Intergenic
1190708248 X:53048398-53048420 CTGCCAGCCTGGTCCTCCCTGGG - Intergenic
1193887399 X:86999538-86999560 GTCCCAGGCTTTTTTTCACTGGG - Intergenic
1200411647 Y:2867663-2867685 CTCCACGCCTGGTTTGCCCTTGG - Intronic
1201329556 Y:12803242-12803264 ATCCCAGCCTTTTTTTCCCTGGG + Intronic