ID: 1059516786

View in Genome Browser
Species Human (GRCh38)
Location 9:114903286-114903308
Sequence GTCCCAGCCTGGTTTTCCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059516783_1059516786 -2 Left 1059516783 9:114903265-114903287 CCATCTCAGGAACAGGGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG 0: 1
1: 1
2: 3
3: 20
4: 201
1059516777_1059516786 29 Left 1059516777 9:114903234-114903256 CCATTGTGGTGGTGTATTAAATT 0: 1
1: 1
2: 0
3: 27
4: 221
Right 1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG 0: 1
1: 1
2: 3
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059516786 Original CRISPR GTCCCAGCCTGGTTTTCCCT GGG Exonic