ID: 1059517629

View in Genome Browser
Species Human (GRCh38)
Location 9:114910468-114910490
Sequence GGGCTTCTGACTTCTAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059517620_1059517629 24 Left 1059517620 9:114910421-114910443 CCCAAGACTCCACAGTAGGTAAA 0: 1
1: 0
2: 0
3: 20
4: 223
Right 1059517629 9:114910468-114910490 GGGCTTCTGACTTCTAATCCAGG No data
1059517621_1059517629 23 Left 1059517621 9:114910422-114910444 CCAAGACTCCACAGTAGGTAAAT 0: 1
1: 0
2: 0
3: 21
4: 185
Right 1059517629 9:114910468-114910490 GGGCTTCTGACTTCTAATCCAGG No data
1059517624_1059517629 15 Left 1059517624 9:114910430-114910452 CCACAGTAGGTAAATGGTGGAGC 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1059517629 9:114910468-114910490 GGGCTTCTGACTTCTAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059517629 Original CRISPR GGGCTTCTGACTTCTAATCC AGG Intronic
No off target data available for this crispr