ID: 1059522488

View in Genome Browser
Species Human (GRCh38)
Location 9:114956728-114956750
Sequence TAGAATACCCACTTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059522488_1059522493 26 Left 1059522488 9:114956728-114956750 CCTGGCTCCAAGTGGGTATTCTA No data
Right 1059522493 9:114956777-114956799 ATATTGAGTGAAATGGTTTGAGG No data
1059522488_1059522491 -2 Left 1059522488 9:114956728-114956750 CCTGGCTCCAAGTGGGTATTCTA No data
Right 1059522491 9:114956749-114956771 TACACATATTTGACAAATGAGGG No data
1059522488_1059522490 -3 Left 1059522488 9:114956728-114956750 CCTGGCTCCAAGTGGGTATTCTA No data
Right 1059522490 9:114956748-114956770 CTACACATATTTGACAAATGAGG No data
1059522488_1059522492 19 Left 1059522488 9:114956728-114956750 CCTGGCTCCAAGTGGGTATTCTA No data
Right 1059522492 9:114956770-114956792 GGACTACATATTGAGTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059522488 Original CRISPR TAGAATACCCACTTGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr