ID: 1059524567

View in Genome Browser
Species Human (GRCh38)
Location 9:114978656-114978678
Sequence GAGAGCTCTGCAGAGCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059524567_1059524570 20 Left 1059524567 9:114978656-114978678 CCTTGGGGCTCTGCAGAGCTCTC No data
Right 1059524570 9:114978699-114978721 CCCACTTATCCGAGTGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059524567 Original CRISPR GAGAGCTCTGCAGAGCCCCA AGG (reversed) Intergenic
No off target data available for this crispr