ID: 1059524806

View in Genome Browser
Species Human (GRCh38)
Location 9:114980727-114980749
Sequence CTTTGCTGGTACCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2253
Summary {0: 1, 1: 4, 2: 45, 3: 384, 4: 1819}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059524803_1059524806 -7 Left 1059524803 9:114980711-114980733 CCTCATCAGATACCAGCTTTGCT 0: 1
1: 0
2: 4
3: 52
4: 440
Right 1059524806 9:114980727-114980749 CTTTGCTGGTACCTTGATTTTGG 0: 1
1: 4
2: 45
3: 384
4: 1819
1059524802_1059524806 6 Left 1059524802 9:114980698-114980720 CCAGGAAGAGTGTCCTCATCAGA 0: 1
1: 16
2: 129
3: 629
4: 1739
Right 1059524806 9:114980727-114980749 CTTTGCTGGTACCTTGATTTTGG 0: 1
1: 4
2: 45
3: 384
4: 1819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059524806 Original CRISPR CTTTGCTGGTACCTTGATTT TGG Intergenic
Too many off-targets to display for this crispr