ID: 1059529487

View in Genome Browser
Species Human (GRCh38)
Location 9:115022950-115022972
Sequence CCTGACATGCAGCAGGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059529487 Original CRISPR CCTGACATGCAGCAGGTGTT GGG (reversed) Intronic
902617248 1:17630522-17630544 CCTAACATGCAGGAGGACTTGGG - Intronic
902651644 1:17841364-17841386 CCTGACAAACACCAGGTTTTAGG + Intergenic
903392047 1:22971510-22971532 CCTGAGAAGGAGCAGGGGTTGGG - Intergenic
905803999 1:40862679-40862701 CCTGACATCCTGCAGCTCTTGGG - Intergenic
905925578 1:41747129-41747151 TCTCTCCTGCAGCAGGTGTTTGG - Intronic
906712765 1:47943885-47943907 CCTGGCAGGCAGTAGGTGTGTGG - Intronic
906831105 1:49032913-49032935 CCAGGAATGCAGCAGGTGTGTGG + Intronic
907316454 1:53575683-53575705 CAGGACATGGAGCAGGTGCTTGG + Intronic
912816581 1:112833535-112833557 CCTGAGAAGCTGCAGGTGTTAGG + Intergenic
913966348 1:143380533-143380555 CCTGGCATACAGCAGGTGCCTGG - Intergenic
914060721 1:144206140-144206162 CCTGGCATACAGCAGGTGCCTGG - Intergenic
914118429 1:144760229-144760251 CCTGGCATACAGCAGGTGCCTGG + Intergenic
914801693 1:150967068-150967090 CCTGACCTCCAGCAGGTAATCGG + Exonic
914973292 1:152331547-152331569 CCTGGCAAGCAGTTGGTGTTGGG + Intergenic
916523515 1:165587684-165587706 CAAGAAATGCAGCAGGTGGTGGG + Intergenic
916786956 1:168093269-168093291 CCTTACAAGCAGAAGGTATTTGG + Intronic
917464368 1:175262191-175262213 CCTGAGAAGCACCAGGGGTTGGG - Intergenic
921330389 1:214029971-214029993 CATCACATGCATCAGCTGTTGGG - Intronic
923538687 1:234872485-234872507 TCTGACATGCAGCAGGTACTGGG + Intergenic
924805654 1:247359426-247359448 CCTGAAACGCAGTAGGTGCTGGG + Intergenic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1066027464 10:31376135-31376157 ACTGACATACAGCAGGTTGTTGG - Intronic
1066382445 10:34912909-34912931 CCTCACATGAGGCAGGTGGTCGG - Intergenic
1067668282 10:48296945-48296967 CCTGACATTCACAAGGTATTTGG + Intergenic
1067764048 10:49071815-49071837 CCACACATGCAGGAGGGGTTGGG + Intronic
1070673042 10:78391560-78391582 CCTGGCCTGCAGGAGGTGGTGGG + Intergenic
1070823387 10:79376084-79376106 CCTGAAATGCCCCTGGTGTTAGG + Intergenic
1070917339 10:80163405-80163427 CCTGAAAGGAAGCAGGTGTATGG + Exonic
1071434677 10:85636074-85636096 CCTGGCATGGATCAGGTGTGAGG - Intronic
1072782592 10:98260676-98260698 CAGGACATCCAGCAGGTGTTGGG - Intronic
1073810408 10:107146551-107146573 CCTGACATACACCAGGTGCTGGG - Intronic
1075046500 10:119150348-119150370 CCTGGCAGGCAGGAGGTGCTGGG + Intronic
1075945134 10:126426258-126426280 CCTGCTATGCAGCAGGTTCTGGG - Intronic
1076708125 10:132313409-132313431 CCTAGCATGGAGCAGGTGCTTGG - Intronic
1077381344 11:2240404-2240426 CCTGACAAACAGCATGTGTTAGG + Intergenic
1077530902 11:3094334-3094356 CCTGAAATGCAGCCAGTGTCAGG + Exonic
1081693514 11:45094289-45094311 CCTGTCCAGCATCAGGTGTTAGG - Intergenic
1081890152 11:46534519-46534541 CCTGAAATCCAGCAGGTGCTTGG + Intronic
1082039065 11:47669952-47669974 CTTGGCATGCAGTAGGTGTTCGG - Intronic
1083887418 11:65579621-65579643 CCTCTCATGCTGCATGTGTTGGG - Intronic
1084026196 11:66451321-66451343 CCTGGCATGCAGTAGGTCTTTGG - Intronic
1084684713 11:70686833-70686855 CCTGGGAAGCAGCAGGTTTTCGG - Intronic
1086299231 11:85407484-85407506 TCTGACACACAGCAGTTGTTTGG - Intronic
1088905114 11:114149463-114149485 CCTTCCATGCTGCAGGTTTTGGG - Intronic
1089309918 11:117551301-117551323 CCTGACACACAGCAGGTGCCTGG - Intronic
1091848172 12:3673729-3673751 CCTCACATGCAGCAAGCATTCGG - Intronic
1093691640 12:22115811-22115833 CAGGACATGCAGCAGGGGTGTGG + Intronic
1096716055 12:53492366-53492388 CCTGGCACGCAGAAGGTGCTCGG + Intronic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1101549263 12:105746830-105746852 CCTGGCACACAGTAGGTGTTTGG - Intergenic
1101965209 12:109277738-109277760 CCTGTCAAGCAGCAGGTCTCAGG + Intergenic
1102734557 12:115146861-115146883 GCTGACATGCAGTAGGAGCTTGG + Intergenic
1103016775 12:117500804-117500826 CAGGACATGCAGCAGGAGCTGGG + Intronic
1103142519 12:118561507-118561529 CCTGACATATAGCAAGTGCTCGG + Intergenic
1103983559 12:124752287-124752309 CCTGGCATACAGTAGGTGCTCGG - Intergenic
1104494073 12:129220224-129220246 CATGACAAGCAGCAGGTTCTTGG - Intronic
1105950348 13:25224304-25224326 CCAGACTTGCAGCTGGTGTCAGG + Intergenic
1106033170 13:26020679-26020701 CCAGCCATGCAGCAGGTGTGGGG - Exonic
1106183115 13:27384970-27384992 CCTGACTTGGAGCAGGAGCTGGG + Intergenic
1107185437 13:37513744-37513766 CCTGCCATGCAGAAAGTGTAAGG - Intergenic
1108025250 13:46170747-46170769 CCTGGCATATAGTAGGTGTTTGG - Intronic
1108514789 13:51190871-51190893 TCTGATATGCAGCAGGATTTTGG - Intergenic
1109099534 13:58163312-58163334 CCTGACAAGCAGAAGGCCTTTGG - Intergenic
1109602141 13:64644887-64644909 CCTCACATGCTATAGGTGTTAGG - Intergenic
1109915782 13:68983603-68983625 CCTGCCATTCAGCAGGTTTCGGG + Intergenic
1109971060 13:69769853-69769875 CCTGCCATTCAGCAGGTTCTGGG - Intronic
1111560730 13:89942327-89942349 CCAAACCTGCAGCATGTGTTAGG + Intergenic
1111893929 13:94117612-94117634 CCTGGCATAGAGCAAGTGTTTGG - Intronic
1111984256 13:95049731-95049753 CCTGACATGCAAAAGAAGTTCGG - Intronic
1113047392 13:106170581-106170603 CCTGGCACATAGCAGGTGTTCGG - Intergenic
1119482349 14:74965953-74965975 CCTGACATGTAGTAAGTGCTTGG - Intergenic
1121709622 14:96027846-96027868 GCAGGCATGCAGCAGGGGTTGGG + Intergenic
1121850555 14:97218478-97218500 CATCACCAGCAGCAGGTGTTTGG - Intergenic
1122157357 14:99758003-99758025 CCTGGCATATGGCAGGTGTTTGG + Intronic
1122703330 14:103604997-103605019 CCTGGCACGCAGGAGGTATTCGG - Intronic
1124259410 15:28175317-28175339 CCTGCTTTGCAGCAGGGGTTGGG - Intronic
1128215881 15:65933721-65933743 CCTGAAAGGCAGCAGGGGTGAGG + Intronic
1128243447 15:66117128-66117150 CCTGGCATGTGGCAGGTGCTGGG + Intronic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1129320104 15:74769995-74770017 CCTGGCATGGAGCAGGTGCTCGG - Intergenic
1131374866 15:91915255-91915277 CCTGGCAAGCAGCAGATGTTCGG + Intronic
1132905555 16:2280917-2280939 CCACAGATGCAGCAGCTGTTTGG + Intronic
1133237773 16:4395597-4395619 CCTGACGTGGAGCAGGTCTCAGG - Intronic
1133238552 16:4401452-4401474 CCTGGCACGCAGCAGGTGCTTGG - Intronic
1134308599 16:13056098-13056120 CCTGACACATAGCAGGTGCTTGG + Intronic
1135808494 16:25566117-25566139 CCTGCCATACAGCAGGGGCTTGG - Intergenic
1138430511 16:56965656-56965678 CCTGCCACACAGCATGTGTTTGG + Intronic
1138925349 16:61583502-61583524 CCCGCCATTCAGCTGGTGTTTGG + Intergenic
1140860356 16:79012764-79012786 CCTGAAACACAGCAGGTATTCGG + Intronic
1141858592 16:86701372-86701394 GCGGGCATGCAGCAGGTGCTCGG + Intergenic
1141940092 16:87269910-87269932 CCTGACACACAACAGGTGCTGGG + Intronic
1142168635 16:88607788-88607810 CCTGACATGAAGCATGTGAATGG - Intronic
1143268555 17:5658761-5658783 CCTGCCATTCAGCAGATGTGAGG - Intergenic
1143652998 17:8275856-8275878 TCTTACATACAGCAGGTGCTGGG - Intergenic
1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG + Intronic
1144950711 17:18992093-18992115 ACAGACATGCCGGAGGTGTTTGG - Intronic
1145266465 17:21381925-21381947 CCTGACATGCAGTGAGTGCTTGG + Intronic
1150635616 17:66911250-66911272 GCTGAGATGGAGAAGGTGTTGGG - Intergenic
1151192162 17:72406583-72406605 CCTGTCTTGGAGCAGGTGTAAGG - Intergenic
1153826155 18:8876760-8876782 CCTGACTTATAGTAGGTGTTTGG + Intergenic
1153995073 18:10433727-10433749 CATGACCTGAGGCAGGTGTTTGG - Intergenic
1157181526 18:45502412-45502434 CCTGGCATGCTGTAGGTGTTTGG + Intronic
1157651744 18:49339903-49339925 CCACACATGGAGCAGGTTTTGGG + Intronic
1159458654 18:68694402-68694424 CCTCACATGGAGCAGGTGCCTGG + Intronic
1160199397 18:76783680-76783702 CCCGAAATGCAGCAGGTCCTTGG + Intergenic
1161301637 19:3545518-3545540 TCTGACATCCTGCAGGTGTCAGG + Intronic
1161414005 19:4134496-4134518 CCTGACACACGGGAGGTGTTTGG + Intergenic
1161520313 19:4720109-4720131 CCTGAAATGCAGGAGGTTCTGGG + Intronic
1162540856 19:11295062-11295084 GCTGACATACAGAAGGTTTTTGG + Intergenic
1163446534 19:17350041-17350063 CTTTACTTGCAGTAGGTGTTGGG + Intergenic
1163794911 19:19332096-19332118 GCTGACATCCAGTAGGTGCTCGG - Intronic
1164686527 19:30169758-30169780 CCTGCCATGCAGCAGGGTTTGGG - Intergenic
1164790526 19:30973816-30973838 ACTGAGATGCAGCACCTGTTAGG + Intergenic
1166210039 19:41300649-41300671 CCCGACATGAAGGAGGTGTTCGG + Intronic
1167276472 19:48543258-48543280 CCTGGCATGCAACAGGTGCTGGG + Intergenic
1168412279 19:56147387-56147409 CCTGACTTGCAGCTGGTGTGGGG - Intronic
1168675777 19:58277161-58277183 CCTGAGAAGGAGCAGGTGTTAGG - Intronic
1202700129 1_KI270712v1_random:158028-158050 CCTGGCATACAGCAGGTGCCTGG - Intergenic
925261088 2:2529243-2529265 CCTGACAGGCAGCAGAGGTGAGG + Intergenic
925300563 2:2808728-2808750 CCTGGCATGGAGCAGGGGCTTGG + Intergenic
925840759 2:7989867-7989889 CCTGACATGTGGCAGGTGTCTGG + Intergenic
926047607 2:9721267-9721289 CCCGACACGCAGTAGGTGTCAGG - Intergenic
926931162 2:18042540-18042562 CCTGACATTCAGCAGCAGCTGGG - Intronic
927926177 2:27015240-27015262 CCTGACATTCAGTATGTATTTGG - Intronic
929782383 2:44965424-44965446 CATGATATTGAGCAGGTGTTAGG + Intergenic
930855943 2:56018236-56018258 CTTTTCATGCAGCAGATGTTTGG - Intergenic
932052896 2:68416753-68416775 CCTGCCATTCAGCAGGTTCTGGG + Intergenic
932286132 2:70533334-70533356 TGTAACATTCAGCAGGTGTTGGG - Intronic
934171062 2:89541503-89541525 CCTGGCATACAGCAGGTGCCTGG - Intergenic
934281367 2:91615821-91615843 CCTGGCATACAGCAGGTGCCTGG - Intergenic
937065309 2:119012799-119012821 CCAGGCCTGCAGCAGGTGCTGGG + Intergenic
937106815 2:119323541-119323563 CCTGACGTGCAGCCGGGGTGAGG - Intronic
942564630 2:177254324-177254346 CCTAACCTGAAGCAGGTGATGGG - Intronic
943258243 2:185625600-185625622 CCTGTCATGCCCCAGGTGTCAGG + Intergenic
944117744 2:196207532-196207554 CCTGACCTTCACCAGGTGTTCGG + Intronic
945041872 2:205749234-205749256 CCTCACTTACAGTAGGTGTTTGG + Intronic
946409724 2:219509977-219509999 CCTGACATGCATGGGGTGTGGGG + Intergenic
947704321 2:232262152-232262174 CTTAACATGAAGGAGGTGTTAGG + Intronic
948233534 2:236369942-236369964 CCTGTCGTGCAGCCGCTGTTTGG - Intronic
948778101 2:240300442-240300464 CCAGGAATGCAGCTGGTGTTGGG - Intergenic
1169155048 20:3322606-3322628 CCTTACATGGAGCAAGTTTTAGG - Intronic
1170438610 20:16355181-16355203 CCTGAGATGCATCAGGGGTGGGG + Intronic
1172580671 20:36044851-36044873 CCTGACACACAGCAGGTGCTTGG - Intergenic
1172889983 20:38257249-38257271 ACTGCCATGCAGCAGGTATGTGG + Intronic
1173413422 20:42835986-42836008 CCTGGCATGAAGGAGGAGTTTGG + Intronic
1173650216 20:44658994-44659016 CCTGGCATGCAACAGGTCCTTGG - Intergenic
1174107057 20:48170062-48170084 CCTGACAGCTAGCAGGTGTGAGG - Intergenic
1174190704 20:48738489-48738511 CCTGAGATGCAGCTGGGGTCAGG - Intronic
1174362420 20:50037340-50037362 CCTGGCACTCAGCAGGTGCTTGG - Intergenic
1177208136 21:18034391-18034413 CCTGTCAGGCAGCAGGGCTTGGG + Intronic
1178749038 21:35283248-35283270 CCTGACAGGAAGCAGGTCTGTGG - Intronic
1178894914 21:36550294-36550316 CCAGACATGCAGCGGGTCTTGGG + Intronic
1179026950 21:37686837-37686859 ATTCACATGCAGCAGGTGTCAGG + Intronic
1179266408 21:39807375-39807397 CCTGACATGACCCAGCTGTTAGG + Intergenic
1180070319 21:45432571-45432593 TCTGAGATGCGGCAGATGTTAGG - Intronic
1180731268 22:17984301-17984323 CCTGGCTGGCAGCAGGTGGTTGG - Intronic
1181511526 22:23391305-23391327 CCTGATGTCCAGCAGGTGTGAGG + Intergenic
1182862437 22:33571642-33571664 CCTGACACCCAGCACGTGCTAGG - Intronic
1183125887 22:35781601-35781623 CCTGACCTCCGGCAGATGTTTGG - Exonic
1184068529 22:42134299-42134321 CCTCAGATGCAGCATGTTTTAGG + Intergenic
1184087225 22:42272115-42272137 CCTGGCATGCAGGAGGTGTTGGG - Intronic
1184287855 22:43482018-43482040 CCTCAGGTGCAGCCGGTGTTGGG + Intronic
1184379785 22:44138108-44138130 GCTGGCATGCAGCAGGTCCTTGG - Intronic
949853089 3:8438565-8438587 CCTGATATGCAGTGGGTTTTTGG + Intergenic
950458458 3:13106419-13106441 CCTGACATATAGCAAGTGCTCGG - Intergenic
951559387 3:23950438-23950460 CCTGACATCCAGTAGGTACTTGG + Intronic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
952436107 3:33274309-33274331 CCTGACTTACAGTAGATGTTCGG - Intergenic
953056039 3:39387896-39387918 CCTGGGGTGCAGCAGGTGCTTGG + Intronic
953093186 3:39749808-39749830 CATGGCAAGCAGCAAGTGTTAGG - Intergenic
953703624 3:45215186-45215208 CCTGCCATGCATGAGCTGTTTGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955160271 3:56458673-56458695 CCTGACAGGAAGCAGGAGGTTGG - Intronic
955573919 3:60338079-60338101 CCTGAGATGCAGCAGGGGACAGG + Intronic
956254584 3:67270536-67270558 CCTGAGATGAAGGAGGAGTTGGG - Intergenic
956600690 3:71018980-71019002 CCACACATGCAGCGGGTGTGTGG - Intronic
959966190 3:112358148-112358170 CATAACATGCAGTACGTGTTTGG + Intronic
960899266 3:122538256-122538278 CCTGACATGTAGGAGGAGCTTGG - Intronic
960985584 3:123278506-123278528 CCTGGCATACAGCAGGCATTTGG - Intergenic
961052788 3:123761356-123761378 CCCAACGTGGAGCAGGTGTTGGG - Intronic
961190950 3:124960998-124961020 CCTGAAAGGAAGCAGGTGTGAGG - Intergenic
961360871 3:126366322-126366344 CCTGACACTCAGCAGGTGGGAGG - Intergenic
962262279 3:133919494-133919516 GCAGACATGCAGAAGGTGATTGG + Intergenic
962625138 3:137218527-137218549 CCTGAAATACTGCAGGGGTTTGG + Intergenic
962751682 3:138438398-138438420 CTTGACAAGCAGCAGGTGGCCGG - Intronic
964667802 3:159192918-159192940 CCTGCAATGCAGCTGGTCTTAGG + Intronic
966861085 3:184231072-184231094 CCTGACCTGCGCCAGGTGCTGGG + Intronic
969135701 4:5027037-5027059 GCTGACAGCCAGGAGGTGTTGGG + Intergenic
969330163 4:6470265-6470287 CCCGGCATGCAGCAGGTGCTCGG + Intronic
970062710 4:12052845-12052867 GCTAACATGAAGCAGGTGTGTGG + Intergenic
973646686 4:52957123-52957145 GCTGACATGCAGAAGGAGTGGGG + Intronic
978377923 4:108095045-108095067 TCAGACCTGAAGCAGGTGTTTGG - Intronic
980626989 4:135386174-135386196 CCTGACATTCAGTAGGTTCTGGG + Intergenic
980869641 4:138595818-138595840 CCTGGCACACAGTAGGTGTTTGG - Intergenic
981219325 4:142213260-142213282 CCTGCCACCCAACAGGTGTTGGG + Intronic
985380411 4:189388958-189388980 CCTCACATGTGGCAGGTGGTGGG - Intergenic
985687957 5:1291945-1291967 CCTGAGCCGCAGCAGGTGTGAGG + Intronic
989069054 5:37490993-37491015 CGTGCCATGCTGCAGGTGCTTGG + Intronic
989433335 5:41381334-41381356 ACTCACATGTAGCAGGGGTTAGG - Intronic
991016014 5:61933488-61933510 CCTGACATGCAGGCTGTCTTAGG + Intergenic
992649005 5:78838881-78838903 TGTGACACCCAGCAGGTGTTGGG + Intronic
992767150 5:80011801-80011823 TCTGATATGTAGCAGGTCTTAGG - Intronic
992957569 5:81925863-81925885 CTGGACTTGCAGCAAGTGTTTGG + Intergenic
994174619 5:96697857-96697879 CCTGGCATTTAGCAGGTGCTGGG + Intronic
997464455 5:134078114-134078136 TCTGGCATAGAGCAGGTGTTGGG - Intergenic
997995803 5:138585399-138585421 CTTAACATGCAGGTGGTGTTGGG + Intergenic
998822279 5:146067679-146067701 CCTGACATCCAGCAGGAGTGTGG + Intronic
999045798 5:148468182-148468204 ACTGCCTGGCAGCAGGTGTTAGG + Intronic
999857679 5:155612934-155612956 CCTGCCATGTATTAGGTGTTTGG + Intergenic
1001146766 5:169191845-169191867 CCTGACATGCTGCAGCAGCTGGG + Intronic
1001697995 5:173686694-173686716 TCTGACATACAGCATGTGCTCGG + Intergenic
1001743270 5:174070886-174070908 CCTGGCATGGAGCAGGCTTTGGG + Intronic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002040807 5:176512780-176512802 CCTGGCACGTAGTAGGTGTTTGG + Intergenic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002349757 5:178575879-178575901 ACTCACATACACCAGGTGTTCGG + Intronic
1002839146 6:890929-890951 CTTGACATTCGGCATGTGTTGGG - Intergenic
1002923451 6:1590307-1590329 CCAGGGATGCAGAAGGTGTTTGG + Intergenic
1003494470 6:6652256-6652278 GCTGACCTGCAGCCGGTGTAGGG - Intronic
1003646362 6:7915822-7915844 CCTGACCTCCAGCTGGGGTTAGG + Intronic
1006586526 6:35118345-35118367 CATCACAATCAGCAGGTGTTTGG - Exonic
1006713266 6:36094690-36094712 CCTGTCATGTACCAGATGTTAGG + Intronic
1007082119 6:39115011-39115033 CCTGACTGGCAGCAGGGGGTTGG + Exonic
1007121058 6:39381890-39381912 TCTGAATTACAGCAGGTGTTAGG - Intronic
1007606310 6:43120536-43120558 CCTAACAAACAGCAGGTGTGTGG - Intronic
1008481264 6:51988016-51988038 CCTGACATATAACAGGTGTTTGG + Intronic
1009997055 6:70907477-70907499 CCAGATATACAGCAGGTTTTAGG - Intronic
1010082565 6:71881299-71881321 CCTCACACAAAGCAGGTGTTTGG + Intergenic
1010203188 6:73300146-73300168 CCTTCCATGTAGCAGGTGTGTGG - Intronic
1015701830 6:136044319-136044341 GCTGACATGCAACAGATCTTAGG - Intronic
1016503220 6:144746398-144746420 CCTGACATGTTGCATGTTTTAGG + Intronic
1016662368 6:146596446-146596468 CCTGACATGGAGCAGGTGGTAGG - Intergenic
1016896217 6:149055936-149055958 ACTGACATGCATTAGGTTTTAGG - Intronic
1017130039 6:151100366-151100388 CCTGACTTGAACCAGATGTTAGG + Intronic
1018847381 6:167565035-167565057 GCTGAAATGCAGCAGATGTGTGG + Intergenic
1019221130 6:170473638-170473660 CCTGACGTACAGCAGTTGCTTGG + Intergenic
1019556461 7:1633914-1633936 CCTGACATGCAGCCCCTGGTGGG + Intergenic
1019754853 7:2761488-2761510 CCTGAATTGCATCAGGTTTTAGG - Intronic
1020093589 7:5355210-5355232 CCTGCCAGGCAGCAGGTTCTGGG + Intronic
1020244057 7:6417098-6417120 CCTGACGTGAAGCAGGTGCCAGG + Intronic
1020410542 7:7887233-7887255 CCTGACATACAGCGTGTGCTCGG + Intronic
1022029718 7:26481231-26481253 CCAGAAATGTAGCAGGTGTAGGG + Intergenic
1022867893 7:34441973-34441995 CATGACATGGATCACGTGTTAGG + Intergenic
1023700703 7:42889132-42889154 CCTGACATGCTCCTGGTGGTAGG - Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1026122623 7:67550923-67550945 CCTAACTAGTAGCAGGTGTTTGG + Intergenic
1029201882 7:98844690-98844712 CCAGACAAGCAGCAGGGGCTGGG + Intergenic
1029261277 7:99304437-99304459 GCTGACATGCTGCTGGGGTTTGG - Intergenic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1031358689 7:120820734-120820756 CCTGTCACACAGCAGGTATTGGG + Intronic
1032406199 7:131657687-131657709 CCTGACAAACAGGAGGTGTTTGG + Intergenic
1036566162 8:9940022-9940044 CCTAACATGCAGTAGGCATTTGG - Intergenic
1037788201 8:21915370-21915392 CCTGAGATGCTGCCGGTGGTGGG + Intergenic
1038310017 8:26439312-26439334 CCTGAGAGGCAGGAGGTGCTTGG + Intronic
1039706402 8:40011869-40011891 CCTGACAGGCTGCAGCTATTAGG - Intronic
1040610689 8:48978490-48978512 CCTGGCATGTAGTAGGTGCTGGG + Intergenic
1041952863 8:63523976-63523998 GCTGACATGCAGTAGGTGCTTGG - Intergenic
1041963475 8:63647348-63647370 CCTGCAATGCAGCAGATGTGTGG - Intergenic
1043218085 8:77621080-77621102 CCTGTCATCCAGTGGGTGTTGGG + Intergenic
1044366060 8:91347098-91347120 CCTGGCATGTGGTAGGTGTTAGG + Intronic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1047029191 8:120857975-120857997 CATGACAAGCAGCTGCTGTTGGG - Intergenic
1048720125 8:137313741-137313763 CCAGACATGAAGTATGTGTTTGG - Intergenic
1049210255 8:141383099-141383121 CCTGACACGTAGAAGGTGTTTGG + Intergenic
1049501968 8:142971733-142971755 CCTGACCTCCTGCAGGTGGTGGG - Intergenic
1050319259 9:4434243-4434265 TCTGGCATACAGCAGGTGCTTGG - Intergenic
1051748394 9:20317233-20317255 ACTCACAGGCACCAGGTGTTAGG + Intergenic
1056373198 9:85979949-85979971 CCAGACATGGAACTGGTGTTTGG - Intronic
1057185268 9:93053908-93053930 CCTGGCATGCAGTAGGTGTTTGG + Intergenic
1057884771 9:98821973-98821995 TCTGACATGCGGTAGGTGCTCGG + Intronic
1058612605 9:106791859-106791881 CCTAGGATGTAGCAGGTGTTGGG - Intergenic
1059529487 9:115022950-115022972 CCTGACATGCAGCAGGTGTTGGG - Intronic
1060459462 9:123836020-123836042 TCTGACACACAGTAGGTGTTTGG + Intronic
1060815903 9:126635021-126635043 GCTGGCATGCAGCGGGTGCTAGG - Intronic
1060910956 9:127349987-127350009 CCCGGCACACAGCAGGTGTTCGG - Intronic
1060987318 9:127827154-127827176 CCTGACACCCAGCATGTGATGGG + Intronic
1061038183 9:128125035-128125057 CCTGAGACCCAGCAGGTGTTTGG + Intronic
1061146205 9:128800284-128800306 CCTGGCAGGCAGCTGGTGTTGGG + Intronic
1061729844 9:132605246-132605268 CCTGGCACGCAGTAGGTGCTCGG - Intronic
1061996284 9:134187841-134187863 ACTGGCACCCAGCAGGTGTTTGG + Intergenic
1062007002 9:134244003-134244025 CTTGTCTTGCAGCAGGAGTTGGG - Intergenic
1062171787 9:135138750-135138772 CCTGACATGAAGCAGTTGTGGGG + Intergenic
1062181804 9:135194992-135195014 CCAGCCATGCAGCAGGTGAGTGG - Intergenic
1187456970 X:19449991-19450013 CCTGGCACGAAGCAGGTGCTTGG - Intronic
1189125173 X:38438078-38438100 CCTGTTCTGCAGCAGGTCTTGGG - Intronic
1191908276 X:66119333-66119355 TTTGATATGCAGCAGGAGTTTGG + Intergenic
1199066791 X:143428743-143428765 TCTGATATGCAGTAGGTGCTTGG + Intergenic
1200000571 X:153057755-153057777 GCTGCCTTGCAGCAGGTGTTCGG + Exonic