ID: 1059529701

View in Genome Browser
Species Human (GRCh38)
Location 9:115024327-115024349
Sequence CAGAAGCAGCATAATGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059529696_1059529701 -5 Left 1059529696 9:115024309-115024331 CCCAGTACTTATTTCCGACAGAA 0: 1
1: 0
2: 0
3: 13
4: 231
Right 1059529701 9:115024327-115024349 CAGAAGCAGCATAATGTGGTGGG 0: 1
1: 0
2: 3
3: 19
4: 218
1059529695_1059529701 -4 Left 1059529695 9:115024308-115024330 CCCCAGTACTTATTTCCGACAGA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1059529701 9:115024327-115024349 CAGAAGCAGCATAATGTGGTGGG 0: 1
1: 0
2: 3
3: 19
4: 218
1059529697_1059529701 -6 Left 1059529697 9:115024310-115024332 CCAGTACTTATTTCCGACAGAAG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1059529701 9:115024327-115024349 CAGAAGCAGCATAATGTGGTGGG 0: 1
1: 0
2: 3
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059529701 Original CRISPR CAGAAGCAGCATAATGTGGT GGG Intronic
903584553 1:24401598-24401620 CAGCACCAGCACAATGTGCTTGG - Intronic
905264840 1:36744470-36744492 CAGAAGCAGCAGAAAGTTGGGGG + Intergenic
905529148 1:38662714-38662736 AAGAAACAGCATTATTTGGTAGG - Intergenic
906702638 1:47871236-47871258 CAGGAGCAGGAGAATGTGCTTGG + Intronic
909151648 1:72013210-72013232 CAGAGGCAGCATTATTTTGTGGG + Intronic
909860014 1:80593449-80593471 CAAAAGCGGCTTACTGTGGTTGG + Intergenic
910867737 1:91803451-91803473 CAGAAGCAGCATGCTGAGGAGGG + Intronic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911664550 1:100538819-100538841 CTGAAGCAGAATAATGGGCTGGG - Intronic
913230768 1:116739190-116739212 CAAAAGCAGCCTAATGTTATCGG - Intergenic
914360858 1:146934795-146934817 CGGAAGCAGGATAAAGAGGTGGG - Intergenic
914491727 1:148155842-148155864 CGGAAGCAGGATAAAGAGGTGGG + Intergenic
915414531 1:155730819-155730841 CAGAAGCATCAAAATGGGGCTGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
920457871 1:206114878-206114900 CAGAAGCAGGATAAAGAGGAGGG + Intronic
921360251 1:214325147-214325169 CAGAAACAGCACAATTTGGAGGG + Intronic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
922006619 1:221537336-221537358 CTGAAGCAGCATGATGTAGTAGG + Intergenic
923538488 1:234871224-234871246 AAGAAAAAGCATGATGTGGTGGG - Intergenic
924885482 1:248210812-248210834 GAGAATCAGCAAAGTGTGGTGGG - Intergenic
1064817278 10:19280206-19280228 CAGATGAAGCATCCTGTGGTAGG + Exonic
1065623252 10:27605503-27605525 CATAAGCAGGATAGTGTGGGTGG - Intergenic
1067247998 10:44562284-44562306 CAACAGCAGAATAAGGTGGTCGG - Intergenic
1067663557 10:48254829-48254851 CACAGCCAGCATAATATGGTGGG - Intronic
1069610630 10:69770253-69770275 CAGAGGCTGCGTAGTGTGGTGGG - Intergenic
1070187488 10:74079215-74079237 AAGAAGGAGCATAACATGGTGGG + Intronic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1071386086 10:85122779-85122801 GAGAAGCATCATAGTGTGTTTGG - Intergenic
1072636488 10:97181705-97181727 GACAAGCAGCAGAATGTGCTGGG + Intronic
1072636709 10:97183016-97183038 GACAAGCAGCAGAATGTGCTGGG + Intronic
1074193808 10:111161718-111161740 AAGAAGCAGTATCATGTGGCTGG - Intergenic
1074349876 10:112726209-112726231 GAGAAGCAGCAGGATCTGGTTGG - Intronic
1076634875 10:131875599-131875621 CAGAAGCAGCTGAAGGTGTTGGG - Intergenic
1077110426 11:859777-859799 CAGAAGCAGCTTAGGGTGATAGG - Intronic
1077976615 11:7253271-7253293 CCAAAACAGCATATTGTGGTTGG + Intronic
1079974999 11:27079928-27079950 TAGAAGCAGCAAGATATGGTTGG - Intronic
1081179027 11:39965224-39965246 GAGGAGCAGCATCAGGTGGTTGG - Intergenic
1086316742 11:85602766-85602788 GAGAAACAGCATACTGTGGTTGG - Intronic
1087973656 11:104517104-104517126 CAGAAGCAGTATAATAGAGTGGG + Intergenic
1088089067 11:106016355-106016377 AAGAAGCAGCATATTGGGGCTGG - Intronic
1088337546 11:108723409-108723431 GTGAAGCGGCATAATGTGTTTGG + Exonic
1088975483 11:114812717-114812739 CAGAAGCAGCACAATGTGATTGG - Intergenic
1090139700 11:124242870-124242892 GACAACCAGCAAAATGTGGTTGG - Intergenic
1090496984 11:127222791-127222813 CAGAAGCAGTATAATCTGGGGGG - Intergenic
1091440078 12:505772-505794 CAGAAGCAGGATAATTTGAGAGG - Intronic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1092633217 12:10408773-10408795 CAGAAGCAGCATATTATCTTGGG + Intronic
1094620701 12:32077798-32077820 CACAATCAGCCCAATGTGGTAGG + Intergenic
1098058263 12:66532542-66532564 CAAGTGCAGCATAATGAGGTAGG - Intronic
1098906977 12:76172414-76172436 CAGTAGCAACATATTGTGATGGG + Intergenic
1098911644 12:76215107-76215129 CAGAAGCAAGATAATGAGGGGGG + Intergenic
1099059903 12:77894705-77894727 TAGAAGCAACAGAATGTGGTAGG + Intronic
1100267866 12:92995505-92995527 TAGAAGCAACACAGTGTGGTTGG - Intergenic
1101751050 12:107582632-107582654 CCGAAGCGGCATCATGAGGTTGG + Intronic
1102159961 12:110760668-110760690 CAGAAGCAGCATCTTGCTGTGGG - Intergenic
1102844120 12:116160438-116160460 GAGAAGCAGCATGATGTAGCAGG + Intronic
1104421893 12:128642840-128642862 CAGAAGCAGCAGGCTGTGGTTGG + Intronic
1107589594 13:41888493-41888515 GTGAAGCAGCATCATGTGTTTGG - Intronic
1108102533 13:46972177-46972199 CTGAAGAAGCATAATGTGTAAGG - Intergenic
1108342775 13:49514258-49514280 CATCAGCAGCATCCTGTGGTAGG + Intronic
1109409941 13:61949946-61949968 CAGAAGAGTCATAATGTGGGAGG + Intergenic
1110509756 13:76335328-76335350 CAGAAGCAGCTGAATCTGTTCGG + Intergenic
1110903541 13:80856192-80856214 CAAAAGCAGAATAATGTTTTGGG + Intergenic
1111664098 13:91245498-91245520 CAAGAGCAGCAGAGTGTGGTTGG - Intergenic
1112467195 13:99654498-99654520 TGGAAGCAGCATAATATGCTGGG - Intronic
1112949826 13:104979364-104979386 CTGAAGGAGCATAATTTAGTTGG + Intergenic
1114810191 14:25889998-25890020 CAGAGGCAGAATAATTTGATTGG + Intergenic
1115944846 14:38648455-38648477 CAGCAGCAGCAAAATGAGTTAGG + Intergenic
1116556442 14:46316217-46316239 CAGAAGCAACAGACTCTGGTGGG - Intergenic
1118098836 14:62571783-62571805 AACAAGCAGCATACTCTGGTAGG - Intergenic
1126105792 15:45146224-45146246 AAAAAGCAGGATCATGTGGTTGG + Intronic
1128198340 15:65780871-65780893 GAGAAGCAGGATAAAGTAGTTGG - Intronic
1131217783 15:90553959-90553981 CAGAGGCTGCATAGTGTGATGGG + Intronic
1131429946 15:92378776-92378798 CAGAAGCAGCATTGAGTGGAAGG - Intergenic
1132347030 15:101114549-101114571 CAGATGCAACATGATGTGGGAGG - Intergenic
1133308244 16:4825148-4825170 AAGAAGCATCATAATCTGATTGG - Intronic
1133798911 16:9069026-9069048 CAGAAGCATAAAAGTGTGGTGGG - Intergenic
1134022873 16:10933562-10933584 CACAAACAGCCCAATGTGGTGGG - Intronic
1135621817 16:23962362-23962384 CAAAAGCAGCACAATGGGGCTGG - Intronic
1136252440 16:29014704-29014726 CAGAAGCAGAATAAAGAGGTGGG - Intergenic
1136529693 16:30859759-30859781 CAGAATCAGCAAAGGGTGGTGGG - Intronic
1137638676 16:50009504-50009526 CAGAAGCAGAAATATATGGTTGG + Intergenic
1140520845 16:75580182-75580204 CTGAAGAAGAATGATGTGGTTGG + Intergenic
1141239091 16:82248461-82248483 CAGAAGCAGCAAGATGTGGGTGG + Intergenic
1143126528 17:4644720-4644742 CAGAAAAATCAAAATGTGGTGGG + Intergenic
1144589966 17:16515476-16515498 AGGAAGCAGCACAGTGTGGTAGG - Intergenic
1144633286 17:16887077-16887099 CAGAAGCAGCATAAGAAGTTGGG + Intergenic
1145371296 17:22308426-22308448 CAGAAGCAGCCAAGTGTGGTGGG + Intergenic
1147891067 17:43717278-43717300 CAGAAACAGCAAAATTGGGTGGG - Intergenic
1148612133 17:48971601-48971623 CAGAAGCAGCAGAATATGCGAGG + Intergenic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1154981792 18:21508541-21508563 AAGCACCAGCATGATGTGGTTGG - Exonic
1155324728 18:24654248-24654270 GAGAAGCAGCCCGATGTGGTAGG - Intergenic
1156031073 18:32713096-32713118 CAAAAGCAGCATAAACTGTTGGG - Intronic
1157647161 18:49286516-49286538 CAGAAGCAGGAGACTCTGGTTGG + Exonic
1157962107 18:52166521-52166543 GAGATGCAGCATAGTGTAGTGGG + Intergenic
1160660663 19:296957-296979 CCGAAACATCATAATGTGGATGG + Intergenic
1162425580 19:10593491-10593513 CAGAAGCAACATAAAGTCTTGGG - Intergenic
1163227591 19:15975485-15975507 TAGAAGCAGGATAAAGAGGTGGG + Intergenic
1164529414 19:29036806-29036828 CAGTGGCAGCATTAGGTGGTTGG - Intergenic
1166732465 19:45066926-45066948 CACAAGCAGGATGAGGTGGTGGG + Intronic
1166783721 19:45355435-45355457 CAGAGGCAGCATAATGTGACAGG - Intronic
1168695604 19:58402301-58402323 CAGAAGGAGCAGAGGGTGGTGGG + Intronic
925814047 2:7729782-7729804 CAGAAGCAGCAAAACGTTGTGGG + Intergenic
926005602 2:9371389-9371411 CAGAAGCAACATATTACGGTGGG - Intronic
926305056 2:11632063-11632085 GAGCACCAGCATGATGTGGTTGG - Exonic
926444775 2:12928823-12928845 CAGATGCAACATAATTTGGGGGG + Intergenic
926464969 2:13176763-13176785 CAGGAGCAGAATGATATGGTTGG - Intergenic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928612685 2:33005905-33005927 GAGTAGCAGCATAAAGTGGTAGG + Intronic
929373673 2:41257856-41257878 CAAAAGCAGCATAGTGTGGTAGG + Intergenic
930799232 2:55425242-55425264 CAGAAGCAGCATATTTGGCTGGG - Intergenic
931624983 2:64249316-64249338 CAGAAGCAGCCTAGTATTGTGGG - Intergenic
935208312 2:100915879-100915901 CAAAAACAGCATAATCTGATAGG + Intronic
935514290 2:104017346-104017368 TTAAAGCAGCATTATGTGGTAGG - Intergenic
935962429 2:108439586-108439608 CAAAAGCATCATAAAGTGATAGG + Intergenic
937842285 2:126535808-126535830 CAGAAGCAGCCCCCTGTGGTGGG + Intergenic
939070758 2:137538794-137538816 CAGAATCAGCATAATATAATAGG + Intronic
939352104 2:141052456-141052478 GAGAAGCAACATAATATAGTCGG + Intronic
939558316 2:143703664-143703686 CAGAAGCTGGAGAATGTGTTAGG + Intronic
940171005 2:150830234-150830256 CAGATGCACCCTAATCTGGTGGG - Intergenic
943585811 2:189738410-189738432 TAGAAGCAGCATGTGGTGGTGGG - Intronic
944275753 2:197835564-197835586 TAGGAGCAGCATGATATGGTAGG + Intronic
944365882 2:198919163-198919185 CAGGAGCAAAATAATGTGGGTGG - Intergenic
945690140 2:213023837-213023859 CAGAGGCATCATAATGTGATGGG - Intronic
946236374 2:218326922-218326944 CAGAAGCAGCACAATATGCCTGG + Intronic
946415527 2:219538098-219538120 CAGGAGCAGGAGAATGTGCTGGG - Exonic
947502481 2:230681551-230681573 CAGAACCAGGGTACTGTGGTGGG + Intergenic
947856838 2:233329870-233329892 CAGATGCAGCACATTGTTGTGGG + Intronic
947978928 2:234392250-234392272 CAGAAGCAAAATATTGTGGGAGG - Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
1172276079 20:33680110-33680132 CAGAAGAAGAATGCTGTGGTTGG - Intronic
1173714493 20:45190512-45190534 CAGAATTAGCATATTGTGGAGGG - Intergenic
1177152492 21:17468959-17468981 CAAAAGCAGCAGAAGTTGGTGGG + Intergenic
1183338053 22:37262215-37262237 CAGCAGCAGCAGATGGTGGTGGG + Intergenic
1183809038 22:40238475-40238497 CAGAAGCAGGATTCGGTGGTTGG - Intronic
949773170 3:7601061-7601083 CACAACAAGCATAATGTGATGGG - Intronic
951335566 3:21417391-21417413 CAAAAGCCGCATGAAGTGGTGGG - Intergenic
951680950 3:25294256-25294278 GAGAAGCAGCATATTCTAGTAGG + Intronic
952081994 3:29770450-29770472 AAGTAGCAGCATAATGTGTCTGG + Intronic
952681629 3:36100073-36100095 CAGAGGCAGGGCAATGTGGTAGG - Intergenic
953656775 3:44860712-44860734 GAGAAGCAGCATGGTGTGGAAGG + Intronic
953740483 3:45534376-45534398 CAGAAGCACTATATTGTGATAGG + Intronic
954854312 3:53629675-53629697 CAGCAGCAGCATTGTGTGCTGGG - Intronic
955143951 3:56297653-56297675 CACAAGCAGGATCATGTGTTTGG - Intronic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
958442076 3:94167596-94167618 CAGAAGCAGTATGATCTGCTAGG - Intergenic
962186974 3:133270538-133270560 CAAAAGCAGCAGCAGGTGGTAGG - Intronic
964120018 3:153173710-153173732 CAGAAGCACAATAGTGTTGTAGG - Intergenic
964314783 3:155432123-155432145 CAGGAGCAGCAGGATGTGTTGGG - Intronic
964654670 3:159052802-159052824 CAGGAGCAGAATGATATGGTTGG + Intronic
966072094 3:175891333-175891355 CAGAAGTAGCTTAATATGTTGGG + Intergenic
968524374 4:1048490-1048512 CAGAAGCAGCCACATGTGGCTGG - Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
970557120 4:17245342-17245364 CAGAAGCAGGAAGATGAGGTGGG + Intergenic
973728741 4:53802858-53802880 CAGGGGCAGCATATGGTGGTTGG + Intronic
975312137 4:72914344-72914366 CAGGGGCAGAATAATATGGTTGG + Intergenic
975939497 4:79625426-79625448 CAGAAGCAGCTTCATGTTGATGG - Intergenic
975972523 4:80058621-80058643 AAAAAGCAAAATAATGTGGTAGG + Intronic
979429996 4:120617753-120617775 CTGAAGGAGCATAATGTGATTGG + Intergenic
984165717 4:176300605-176300627 CAGAAGCAGCATAGTTTGGGTGG - Intergenic
984855444 4:184191164-184191186 AAGAGGCAGCATGATGTTGTGGG + Intronic
985262076 4:188124037-188124059 AAGCATCAGCATCATGTGGTGGG - Intergenic
986238828 5:5938548-5938570 CAAAAACAGCATGATGGGGTGGG + Intergenic
988696306 5:33625961-33625983 CAGAAAGAGCATACTGTTGTGGG - Intronic
990486561 5:56264915-56264937 CATAAGCTTCCTAATGTGGTGGG + Intergenic
990882222 5:60552069-60552091 AATAAGCAGGAAAATGTGGTGGG + Intergenic
992945866 5:81809770-81809792 CAGAAGCATCATAATATATTGGG + Intergenic
993998045 5:94745744-94745766 GAGAAGCAGCACAAAGTGCTCGG + Intronic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
997075941 5:130677161-130677183 CAGAAACAGTACAATGTGATAGG + Intergenic
998349338 5:141490822-141490844 CAGATGCTGCAGATTGTGGTGGG + Exonic
998632305 5:143912845-143912867 TAGAAACAGCATAATTTAGTGGG + Intergenic
999001904 5:147932836-147932858 TTGAAGCAGCTTTATGTGGTAGG - Intergenic
1000191340 5:158914032-158914054 CAGAAACAACCTGATGTGGTGGG + Intronic
1001088008 5:168715523-168715545 CAGAAGCAGTTTAATTTTGTGGG + Intronic
1001633540 5:173194063-173194085 CAGATGAAGCACAATGTGGATGG - Intergenic
1003435763 6:6086544-6086566 CAGAAGTATCAGGATGTGGTGGG + Intergenic
1004806967 6:19212890-19212912 CAGAGTCAGCAAAGTGTGGTGGG - Intergenic
1005121521 6:22394685-22394707 CAGAATCAGCATAATATAATTGG + Intergenic
1006848079 6:37077230-37077252 CAGAGGCAGGAGAATCTGGTGGG + Intergenic
1008339066 6:50342940-50342962 ATGAAGCAGAATAATATGGTGGG - Intergenic
1010284942 6:74065891-74065913 CAAAAGCTGCAGAAAGTGGTCGG - Intergenic
1010476194 6:76291142-76291164 CAGAAGCAGCAAAATGGAATAGG - Intergenic
1013772913 6:113647445-113647467 CCCAAGCAGCACATTGTGGTAGG + Intergenic
1014500649 6:122185195-122185217 GAGAAGTAGCATAGGGTGGTGGG - Intergenic
1014986584 6:128018788-128018810 CAGAAGCAGCATTAGATGGAGGG + Intronic
1015159444 6:130136150-130136172 CAGAAGCAGGAAAATGAGTTTGG - Intronic
1015506374 6:133992964-133992986 CAGAAGCTGACTGATGTGGTTGG - Intronic
1015995215 6:138989614-138989636 CAGAAAGAGCACAATGGGGTAGG + Intergenic
1016041328 6:139434601-139434623 CAGCAGCAGGGTTATGTGGTGGG - Intergenic
1017379467 6:153811949-153811971 GAGATGCAGCCTAATGTGTTTGG - Intergenic
1017438224 6:154437961-154437983 CAGAAGGAGTAGACTGTGGTAGG - Intronic
1017712197 6:157180938-157180960 CAGAAGCAGCATGTGGAGGTGGG - Intronic
1018653416 6:166010018-166010040 TAGAAGCAGCACAATGTCCTGGG + Intergenic
1019706423 7:2499229-2499251 CTGAAGCAGCATCATGGGGCTGG + Intergenic
1021757413 7:23866729-23866751 CAGAGGCACCATAACGTGGTGGG + Intergenic
1023450758 7:40282537-40282559 CAGATGCAGAAGAATGAGGTTGG + Intronic
1023686917 7:42745579-42745601 CAGAAGCATCATCATGAGCTGGG - Intergenic
1024623324 7:51182576-51182598 CAGAAGCAGAATTTTGTGGCCGG - Intronic
1024836834 7:53530525-53530547 TAGAAGCAGCAAATTGTGGGGGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1028270737 7:88785707-88785729 AAGAAGAAGCATACTGTGTTGGG - Intronic
1028496559 7:91467389-91467411 CAGCAGCAGGAAAATGTGATGGG - Intergenic
1029839234 7:103344611-103344633 CAGAAGCAGCATGATGGCGCCGG + Exonic
1030906712 7:115193563-115193585 GAGAAGCATCAGAATTTGGTTGG - Intergenic
1031958686 7:127969043-127969065 CAGAGGCAGCAAAAGATGGTGGG - Intronic
1031978120 7:128106613-128106635 CAGAAGCTGGAAGATGTGGTTGG - Intergenic
1034005969 7:147472614-147472636 AAGAAGCTGCAAAATGGGGTGGG + Intronic
1037635141 8:20694919-20694941 AAGAAGCAGAGTAAGGTGGTGGG - Intergenic
1039068598 8:33630957-33630979 CAGACACAGCATAATTAGGTGGG + Intergenic
1039182240 8:34879835-34879857 GAAAAACAGCATAATGTGGTAGG - Intergenic
1040835854 8:51731001-51731023 CAGGGGCAGAATGATGTGGTTGG - Intronic
1041865259 8:62565596-62565618 TAGAAGCAACATTATGTAGTAGG - Intronic
1042659336 8:71136155-71136177 CAGAAGCAGCATGATATGAACGG - Intergenic
1042940166 8:74099386-74099408 GAGGGGCAGCATAAGGTGGTTGG - Intergenic
1043367684 8:79554376-79554398 CAGAAGTAGCTTAGTTTGGTAGG - Intergenic
1045640174 8:104241102-104241124 TAGAAGCAGCTTAGTGGGGTGGG - Intronic
1046567802 8:115922827-115922849 CAGAAGCAGCTTAGTTGGGTGGG - Intergenic
1046747605 8:117892924-117892946 CAGAAGCAACATATTGGGGAGGG + Intronic
1047299183 8:123598108-123598130 CAGAAGCAACAGAATGTGTGGGG + Intergenic
1050001532 9:1082609-1082631 TAGAACCAGCACACTGTGGTAGG - Intergenic
1050780574 9:9329185-9329207 CAGAAACAGGATAATATGGCTGG + Intronic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054968398 9:71056261-71056283 AAGAGGCAGCATACTGTGATTGG - Intronic
1057332085 9:94124951-94124973 CACATGCAGAATAATGTGGTTGG - Intergenic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1059529701 9:115024327-115024349 CAGAAGCAGCATAATGTGGTGGG + Intronic
1060109797 9:120898622-120898644 TAGAAGCAGCATAATGTTGTGGG - Intergenic
1061444603 9:130630863-130630885 CACAAGCAGCACAAGGTGGTGGG - Intronic
1186528224 X:10269120-10269142 CAGAGGCAGCATAATGAGTAGGG + Intergenic
1187618810 X:21027847-21027869 CAGCCACAGCATGATGTGGTGGG - Intergenic
1192752914 X:74013076-74013098 CAGCAGCACTATAATGTAGTAGG + Intergenic
1193642947 X:84034271-84034293 CAGAAGCAGAATAATCTAGTGGG - Intergenic
1194125624 X:90012734-90012756 CAAAACCAGCATCATGTGGAAGG - Intergenic
1194951665 X:100134746-100134768 CAGAAGCAGCACAATATTGGTGG + Intergenic
1197143341 X:123141423-123141445 CAGAAACAGCATAAAGCAGTGGG + Intergenic
1199761026 X:150904078-150904100 CAGAAACAGCCCAGTGTGGTGGG + Intergenic