ID: 1059529924

View in Genome Browser
Species Human (GRCh38)
Location 9:115026551-115026573
Sequence CGCTACAAGCTGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059529924_1059529931 21 Left 1059529924 9:115026551-115026573 CCCTCCACCTTCAGCTTGTAGCG 0: 1
1: 0
2: 0
3: 6
4: 211
Right 1059529931 9:115026595-115026617 GAACTTGTCATAGACAGCAAAGG 0: 1
1: 0
2: 0
3: 14
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059529924 Original CRISPR CGCTACAAGCTGAAGGTGGA GGG (reversed) Exonic
906258202 1:44366767-44366789 CGCTGCAAGCTGTGGGTGGTAGG + Intergenic
906766643 1:48440187-48440209 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
907842305 1:58169835-58169857 CCCTTCAAGCTGTAGGGGGAAGG + Intronic
908659795 1:66423897-66423919 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
910122255 1:83803130-83803152 TGCTACATGCTGAAGATGCATGG + Intergenic
911298931 1:96150107-96150129 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
912021261 1:105111219-105111241 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
915260527 1:154673686-154673708 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
915298694 1:154939870-154939892 CTCAGCAGGCTGAAGGTGGAAGG - Intergenic
916055886 1:161068831-161068853 GGCTTGAAGCTGGAGGTGGAGGG - Intronic
916083591 1:161252325-161252347 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
916939490 1:169664207-169664229 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
917279846 1:173370047-173370069 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
917445837 1:175105319-175105341 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
917676241 1:177321812-177321834 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
919204253 1:194400197-194400219 CTCTACAAATTGAAGGTGAAAGG - Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
920513639 1:206568374-206568396 CCCTCAAAGCTGCAGGTGGAGGG + Intronic
921019664 1:211224384-211224406 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
922674022 1:227540254-227540276 AGCTACATGCAGAAGATGGATGG + Intergenic
1063859121 10:10289522-10289544 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1065082377 10:22140993-22141015 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1066320322 10:34296696-34296718 CAGTACATGCTGATGGTGGATGG + Intronic
1066614606 10:37282434-37282456 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1068500278 10:57834877-57834899 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1069137369 10:64782622-64782644 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1069365121 10:67688238-67688260 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1071713606 10:88073793-88073815 GGCTACAAGGGGAAGGTGGGGGG - Intergenic
1071834825 10:89408561-89408583 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
1073229642 10:101958095-101958117 AGCTAGCAGCTGAGGGTGGAAGG - Intronic
1073970723 10:109043467-109043489 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1076260344 10:129060027-129060049 GGATACAGGCTGAAGCTGGATGG + Intergenic
1079731249 11:23939392-23939414 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1081421396 11:42877159-42877181 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1083675686 11:64323489-64323511 AGCTGCTTGCTGAAGGTGGAGGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088492517 11:110401570-110401592 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1091573937 12:1714988-1715010 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1091626147 12:2122399-2122421 TGCTGCCAGCTGAAGGTGGGGGG + Intronic
1091812527 12:3411327-3411349 TGCTACAATCTGAAAGAGGAAGG - Intronic
1094294968 12:28895375-28895397 CGTGGCAAGCTGAAGGTGAAAGG + Intergenic
1094848486 12:34371931-34371953 GGGGACAAGCTGAAGGTGGCAGG - Intergenic
1095536523 12:43254775-43254797 TGCTACTAGCTGAAGCTGGTTGG - Intergenic
1097428281 12:59473052-59473074 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1099376228 12:81898619-81898641 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1099414763 12:82372273-82372295 CCCTTCAAGCTGTAGGGGGAAGG - Intronic
1100092126 12:90984831-90984853 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
1103178330 12:118884746-118884768 GGCTACAAGCTGTAGGTTCAAGG - Intergenic
1104732308 12:131114543-131114565 GGCTACAAGCTGAAGTCGGGGGG + Intronic
1105762464 13:23527020-23527042 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1106162671 13:27214902-27214924 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1109303686 13:60615758-60615780 CACTAAAAGCTGTAGGTGAAGGG + Intergenic
1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG + Intergenic
1112519097 13:100080461-100080483 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1112538348 13:100282978-100283000 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
1115285480 14:31709753-31709775 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1115919956 14:38361467-38361489 CTCCACAAGCTGAAAGAGGAAGG + Intergenic
1115969418 14:38928809-38928831 AGCCACAAGATGAAGGTTGAAGG + Intergenic
1118814183 14:69298327-69298349 ATCTACAAGCTGAAGGAGGGAGG - Intronic
1126086095 15:45012434-45012456 CTCTTCAAGCTGTAGGGGGAGGG + Intergenic
1129026780 15:72583532-72583554 CGTTACAAGTTAAAGTTGGAGGG - Exonic
1131254387 15:90852510-90852532 CCCTACAAGCTGGATGTGGCAGG - Intergenic
1135339698 16:21635268-21635290 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140910870 16:79451150-79451172 CCCTGCAAACTGAAGGTGGTGGG - Intergenic
1144618167 17:16796029-16796051 ATCTACAACCTGTAGGTGGAGGG - Intronic
1144894537 17:18519666-18519688 ATCTACAACCTGTAGGTGGAGGG + Intergenic
1145214441 17:21041978-21042000 CGCGAGGAGCTGGAGGTGGAGGG - Intronic
1146310481 17:31764656-31764678 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1148755928 17:49972901-49972923 CGCTCCACGCGGAAGGTAGAGGG + Intronic
1151567986 17:74910531-74910553 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1151982972 17:77525177-77525199 CGCTTCACGCTGAAGGTGACGGG + Intergenic
1152350529 17:79781787-79781809 CGCTCCAAGCTCAAGGTGGGTGG + Exonic
1153438023 18:5087631-5087653 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1163272331 19:16261798-16261820 GGCTACAAGTAGGAGGTGGAGGG + Intergenic
1165847052 19:38824898-38824920 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
926697275 2:15779667-15779689 AGCTACAAAATGAAGGTGCAAGG + Intergenic
928176084 2:29035302-29035324 GGCAACAAGCTGTAGGTGGAGGG + Intronic
928617658 2:33055806-33055828 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
930038489 2:47102755-47102777 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
930203600 2:48566887-48566909 CGTTACAGGCTGAAGTTGAAAGG + Intronic
931944472 2:67289666-67289688 CTATACCAGCTAAAGGTGGAAGG - Intergenic
933342119 2:81037432-81037454 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
935726130 2:106025643-106025665 GGCTACACCCTGCAGGTGGAGGG + Intergenic
941243378 2:163068932-163068954 CCCTTCAAGCTGCAGGGGGAGGG + Intergenic
943103109 2:183510768-183510790 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
944728962 2:202499089-202499111 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
945315773 2:208369447-208369469 CGCTTGAACCGGAAGGTGGAGGG - Intronic
945564472 2:211379905-211379927 TGCTACTAGATGAAGTTGGAAGG - Exonic
946207394 2:218119760-218119782 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1170487404 20:16832767-16832789 AGATGCAAGCTGAAGGAGGAGGG - Intergenic
1170741633 20:19063704-19063726 TGCTAGTAACTGAAGGTGGAAGG + Intergenic
1171085310 20:22233144-22233166 TTCTACATGCTGAAGGGGGATGG + Intergenic
1171261473 20:23738102-23738124 CCCTTCAAGCTGTAGGGGGAAGG + Intergenic
1171270613 20:23813993-23814015 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1172340613 20:34154606-34154628 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1177135027 21:17298964-17298986 CCCTTCAAGCTGAAAGGGGAGGG + Intergenic
1183634817 22:39054927-39054949 GGCTACAAGTCCAAGGTGGAGGG + Intronic
951239436 3:20271858-20271880 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
953622982 3:44548734-44548756 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
953687150 3:45086982-45087004 CGTTACAAGCTGAAGGTACCAGG - Intronic
954232308 3:49226898-49226920 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
954598888 3:51852342-51852364 CCCTTCAAGCTGGAGGGGGAGGG + Intergenic
956303364 3:67796841-67796863 CGCTGCAAACTGAGGGTGGATGG + Intergenic
958549249 3:95593304-95593326 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
960063648 3:113348703-113348725 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
963021214 3:140874525-140874547 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
963409257 3:144907677-144907699 CACTTCAAGCTGTAGGGGGAGGG - Intergenic
963696710 3:148573014-148573036 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
964590768 3:158360550-158360572 CGGCTGAAGCTGAAGGTGGAGGG - Intronic
965062709 3:163803765-163803787 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
966407418 3:179612238-179612260 CTCCGCAAGCTGAAGGTGGGAGG + Intronic
966466078 3:180232630-180232652 GGGTACAGGCTGAAGATGGATGG - Intergenic
967148225 3:186624843-186624865 AACGACAAGGTGAAGGTGGAGGG + Intergenic
967583576 3:191187619-191187641 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
968078691 3:195831791-195831813 CACTGGAAGCTGAAGATGGAGGG + Intergenic
971281250 4:25244194-25244216 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
971578427 4:28305197-28305219 CCCTTCAAGCTGTAGGGGGAAGG + Intergenic
974526511 4:63055032-63055054 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
975145198 4:70959315-70959337 CGCTAGAGGCTGAGGGTGGGAGG - Intronic
975595891 4:76047997-76048019 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
977210072 4:94208179-94208201 CGCAACAATTAGAAGGTGGACGG - Intronic
977884049 4:102237485-102237507 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
980290942 4:130847028-130847050 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
982701077 4:158660167-158660189 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
982877252 4:160664537-160664559 CACTTCAAGCTGTAGGGGGAGGG + Intergenic
984917399 4:184736621-184736643 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
986130177 5:4922907-4922929 ACGTACAAGCTGCAGGTGGATGG + Intergenic
986703268 5:10432473-10432495 AGCAACAAGCTGTAGGTGGCTGG - Intronic
986908310 5:12521814-12521836 CACTCAAAGCTGAAGGTGAATGG - Intergenic
986933262 5:12853654-12853676 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
987332497 5:16869566-16869588 CGCTAAAAACAGAAGGTGGCCGG + Intronic
987480798 5:18454771-18454793 CTCTACAAGCTTAATGTAGAGGG + Intergenic
987929847 5:24389367-24389389 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
990367919 5:55088990-55089012 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
992049311 5:72928499-72928521 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
992455149 5:76909685-76909707 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
992545722 5:77812199-77812221 CCCTTCAAGCTGTAGGTGGAGGG + Intronic
995524707 5:113041214-113041236 GCCTCCAAGCTGATGGTGGATGG - Intronic
996099282 5:119430655-119430677 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
996121424 5:119677926-119677948 CGTTACAGGATGAATGTGGATGG - Intergenic
996680331 5:126223488-126223510 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
997072351 5:130635785-130635807 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
998111411 5:139505524-139505546 CTCTTCAAGCTGTAGGGGGAGGG + Intergenic
999817887 5:155196046-155196068 CTCTAGAAGCTTAAGTTGGAAGG - Intergenic
1002058475 5:176612142-176612164 CGGCACCAGCTGGAGGTGGATGG - Intergenic
1003823651 6:9928090-9928112 AGTTCCAAGGTGAAGGTGGAAGG - Intronic
1007029975 6:38618602-38618624 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
1008587051 6:52959857-52959879 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1009385994 6:63084608-63084630 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1009872725 6:69470328-69470350 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1010074892 6:71787747-71787769 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1010269777 6:73906068-73906090 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1011375105 6:86679197-86679219 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1012744425 6:103066514-103066536 AGATACAATGTGAAGGTGGATGG - Intergenic
1013413691 6:109905529-109905551 CTCTACCAGCTGAAGGTGGTAGG + Intergenic
1013977365 6:116093283-116093305 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1016183972 6:141178352-141178374 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1017550884 6:155506063-155506085 CGTGCCAAGATGAAGGTGGAGGG + Intergenic
1018900569 6:168049854-168049876 CGCTACAAGCTGAAGAGGACAGG - Intergenic
1022505089 7:30904784-30904806 TGCAACAAGCTCCAGGTGGAGGG - Intergenic
1026169922 7:67945046-67945068 CGCTACCAGCTCAGGATGGATGG + Intergenic
1027791055 7:82639269-82639291 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1028495281 7:91454135-91454157 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1031731720 7:125310012-125310034 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1033759311 7:144422732-144422754 CCCTTCAAGCTGCAGGAGGAGGG - Intergenic
1033965088 7:146965574-146965596 GGGTACAAGCAGAAGTTGGATGG + Intronic
1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG + Intergenic
1038430848 8:27498212-27498234 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1039693238 8:39883305-39883327 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1039999741 8:42565963-42565985 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1040667936 8:49654814-49654836 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1040953326 8:52956833-52956855 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1040965122 8:53074904-53074926 CCCTTCAAGCTGTAGGGGGAAGG - Intergenic
1041000000 8:53440670-53440692 CCCTTCAAGCTGTAGGAGGAGGG - Intergenic
1041001844 8:53461772-53461794 CCCTTCAAGCTGTAGGAGGAGGG + Intergenic
1042771844 8:72390142-72390164 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1042919548 8:73908204-73908226 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1044005500 8:86932324-86932346 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1045858484 8:106790748-106790770 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1048925148 8:139264886-139264908 GGCTGCAACCTGAGGGTGGAGGG - Intergenic
1050444720 9:5707737-5707759 GGAAACAAGTTGAAGGTGGAAGG - Intronic
1051935207 9:22436731-22436753 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1052989768 9:34512358-34512380 GTCATCAAGCTGAAGGTGGAAGG + Exonic
1053221865 9:36319212-36319234 CACTACCAGCTGAAGGTGAGTGG + Intergenic
1055458349 9:76493555-76493577 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1057505969 9:95633796-95633818 CGCTTGAACCTGGAGGTGGAAGG + Intergenic
1059529924 9:115026551-115026573 CGCTACAAGCTGAAGGTGGAGGG - Exonic
1060185714 9:121562951-121562973 GGCTACAAGGGGAAGGTGGCCGG - Intergenic
1061730777 9:132612164-132612186 CGCCACATGCCCAAGGTGGAGGG + Exonic
1188097453 X:26042303-26042325 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1188254388 X:27942505-27942527 TGCTTCAAGCTGGAGGGGGATGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1192482833 X:71500004-71500026 CCCTTCAAGCTGTAGGAGGAGGG - Intronic
1192870084 X:75176563-75176585 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1195552455 X:106184827-106184849 CCCTTCAAGCTGTAGGGGGAAGG - Intronic
1196065708 X:111462020-111462042 CTCTAGAAGCTGAAAATGGAAGG - Intergenic
1196127422 X:112114607-112114629 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1196419454 X:115507436-115507458 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1196488918 X:116245690-116245712 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1196662014 X:118279731-118279753 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1198028120 X:132728949-132728971 TGATACAGGCTGAAGGTGGAGGG - Intronic
1199973598 X:152878112-152878134 CTCTAAACACTGAAGGTGGAAGG - Intergenic
1200116875 X:153773358-153773380 CGCTACAAGCTGGGGGTTGGCGG - Exonic
1200776157 Y:7171977-7171999 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1200801088 Y:7387682-7387704 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1200880863 Y:8210202-8210224 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1200959244 Y:8982057-8982079 CTCTTCAAGCTGTAGGGGGAGGG + Intergenic
1201407572 Y:13664163-13664185 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1201487511 Y:14508509-14508531 CCCTTCAAGCTGTAGGGGGAAGG + Intergenic
1201648955 Y:16264713-16264735 TGCTTCAAGCTGTAGGGGGAGGG - Intergenic
1201653854 Y:16320587-16320609 TGCTTCAAGCTGTAGGGGGAGGG + Intergenic
1202074761 Y:21026910-21026932 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1202146754 Y:21806702-21806724 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic