ID: 1059531486

View in Genome Browser
Species Human (GRCh38)
Location 9:115039538-115039560
Sequence GGAAATGGTCAGATTCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059531486_1059531489 26 Left 1059531486 9:115039538-115039560 CCAGCATGAATCTGACCATTTCC 0: 1
1: 0
2: 3
3: 10
4: 121
Right 1059531489 9:115039587-115039609 TGTGCCCATGCCAGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059531486 Original CRISPR GGAAATGGTCAGATTCATGC TGG (reversed) Intronic
902722961 1:18316266-18316288 AGCAGTGGTCAGATTCATGCTGG - Intronic
903248118 1:22031790-22031812 GGGAGTGGTCAGCTGCATGCTGG + Intergenic
903328292 1:22583840-22583862 GGAAAGGGTCAGAGACTTGCAGG + Intronic
904051133 1:27639560-27639582 GGTAATGGTTAGATTCCTGCAGG - Intergenic
905311540 1:37052346-37052368 GGAAATGATCTGACTCATTCAGG - Intergenic
908623153 1:66008353-66008375 GGAAATGGGCACAATCAAGCAGG - Intronic
908997710 1:70177430-70177452 GGAAATGATTAGCTTCATACAGG - Intronic
909287573 1:73839078-73839100 GGAAATGCTCAAATTCTTGTTGG - Intergenic
911097068 1:94063415-94063437 GGAAATGGTCAAATGCAAGGAGG + Intronic
911591599 1:99754167-99754189 AGAAATGGACAGATCCAGGCTGG + Intronic
912874081 1:113338329-113338351 TGAAATTGTCAGTTTCATGTAGG + Intergenic
914980424 1:152410207-152410229 GGACATGCTCAGATACAGGCAGG - Exonic
915754809 1:158249455-158249477 GGAACTGATCACATTCATGAGGG + Intergenic
916149084 1:161768338-161768360 GGAAATGGGCACATTCAGGGAGG - Intronic
916574632 1:166056530-166056552 GTAAATGGTCAGATTCATCCAGG - Intergenic
917178429 1:172265060-172265082 AGCAATGGTCAGTTCCATGCAGG - Intronic
924221496 1:241880375-241880397 TGAAATAGTAAGATGCATGCTGG - Intronic
1062939073 10:1408563-1408585 TGAGATGGGCATATTCATGCTGG - Intronic
1069125581 10:64628697-64628719 GGAAAAGGTAACATTCAAGCAGG - Intergenic
1079187962 11:18254196-18254218 GGAAATGGTTTCATTCAGGCTGG - Intergenic
1082757060 11:57087821-57087843 TGAAAGGGTCAGATCCCTGCTGG + Intergenic
1087558939 11:99759579-99759601 GGAAATGGTTATATTAATTCAGG + Intronic
1087692826 11:101341447-101341469 GGGAAGGGTCAGATTAATACTGG + Intergenic
1090411396 11:126512196-126512218 GGAAATGGACACATTCTTGGAGG - Intronic
1091278854 11:134370605-134370627 GGAAGAGGACAGACTCATGCTGG + Intronic
1093768117 12:22988280-22988302 GGTAATGGCCACATTCAGGCTGG + Intergenic
1095902409 12:47341626-47341648 GGCAATGGTGATATTCTTGCTGG + Intergenic
1098980892 12:76954680-76954702 GGAAAGGGGCAGATTCAAACAGG - Intergenic
1100341091 12:93679805-93679827 GGAAAAGGTCAGATTCATGGAGG + Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1101863537 12:108502257-108502279 GGAAATCACCTGATTCATGCAGG + Intergenic
1103924681 12:124416937-124416959 GGACATGGGGAGCTTCATGCTGG - Intronic
1107692150 13:42964490-42964512 GGGCATGGTCATATTCAAGCAGG - Intronic
1110442411 13:75539865-75539887 AGAAATCGTCTGATTCATTCAGG - Intronic
1118466606 14:66037000-66037022 GAAAGTGATCAAATTCATGCAGG - Intergenic
1119104097 14:71907624-71907646 GGATATGTTCAGATTTATGTGGG + Intergenic
1123873559 15:24600631-24600653 GGAAAAGGTAACATTCAAGCAGG - Intergenic
1130216208 15:81972505-81972527 GAAAACTGTCAGATTCATGGTGG - Intergenic
1131253645 15:90847047-90847069 AGAAATGGTCAGAATGATGCTGG - Intergenic
1131837454 15:96405450-96405472 GGAAGTGGAAAGATTGATGCAGG - Intergenic
1133247046 16:4455810-4455832 GGAGATGGTTAGACTCTTGCAGG + Exonic
1137879771 16:52034035-52034057 GGAAATGGTCAGCTTTCTGCTGG + Intronic
1140029185 16:71320978-71321000 GGAAATGGTAAGTTTCATGAGGG + Intergenic
1142073390 16:88103609-88103631 GAAGATGATCTGATTCATGCAGG - Intronic
1144217947 17:13073115-13073137 GGAAATGTTCAGATTGAAACTGG - Intergenic
1145897374 17:28467249-28467271 GGAGGTGGTAAGATTAATGCTGG - Intronic
1149769142 17:59306189-59306211 AGAAATGGACACATTCATTCAGG + Intergenic
1149988102 17:61363773-61363795 GGAAAGGGTCAGTTTCAAGCAGG - Intronic
1151346041 17:73501940-73501962 GGACAGGGTCATATTCATGCAGG + Intronic
1153238380 18:3010063-3010085 GGGAATGGCCAGAATCCTGCCGG - Intronic
1153808958 18:8734948-8734970 GGAGTTGGTCAGATTAATGAAGG + Intronic
1155015528 18:21835266-21835288 TGAAATGGTCAGATTTGTGTGGG + Intronic
1156349118 18:36287812-36287834 GGACATGTTCAGAGTCATGTGGG + Intergenic
1156649555 18:39208966-39208988 GGAAATGGACAAATACAAGCAGG + Intergenic
1157287967 18:46390186-46390208 GGAACTGGGCCGATTCCTGCTGG + Intronic
1157615546 18:48985413-48985435 GGAAATGATAAGATTCATAGAGG - Intergenic
1162270853 19:9614005-9614027 ACAAATGGTAAGATTCATGAGGG - Exonic
1162276127 19:9656531-9656553 ACAAATGGTAAGATTCATGAGGG - Exonic
1164598849 19:29547869-29547891 GGGAATGGTCAGATTGAAGTGGG + Intronic
1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG + Intronic
1167872628 19:52385736-52385758 GGAAATGGTCAGTTATATTCAGG + Exonic
930103384 2:47619813-47619835 AGAAGAGGTCAGAGTCATGCAGG + Intergenic
933174608 2:79160954-79160976 GCAAATGGTCAGCTTCATATGGG + Intergenic
933882248 2:86681225-86681247 GGAAAAGGTGACATTCAAGCGGG + Intronic
934607609 2:95709020-95709042 AGAAATGATCAGATGGATGCAGG - Intergenic
936540954 2:113350885-113350907 AGAAATGATCAGATGGATGCAGG - Intergenic
939894848 2:147778880-147778902 TGAAATGGTCATATTCATATAGG - Intergenic
940205152 2:151194263-151194285 GTAAATAGTCAGTTTCATTCGGG + Intergenic
945699057 2:213148818-213148840 GCAAATGATCTGATTCCTGCTGG + Intronic
946215993 2:218183993-218184015 GGAAAAGGCAACATTCATGCAGG + Intergenic
947352341 2:229259300-229259322 TGAAAAGGTAAGATTCAGGCTGG - Intronic
948451535 2:238077745-238077767 GGCAAGGGTCAGATACATTCAGG - Intronic
948567827 2:238897744-238897766 GGAGGTGGCCAGCTTCATGCTGG + Intronic
1170434802 20:16315391-16315413 GGAAAGGCTCAGAGTCATGGGGG + Intronic
1172566734 20:35936432-35936454 GGAAGTGGTCATATACATGAAGG - Intronic
1173712652 20:45174444-45174466 GGAAATGCCCAGTTTGATGCTGG + Intergenic
1174506602 20:51021580-51021602 GGAACTGGTCTGATTCATTGTGG - Intronic
1179124447 21:38578596-38578618 GAACATGGCCAGATGCATGCGGG + Intronic
1181619155 22:24076350-24076372 GGAAGGGGACAGATTCATGTTGG + Intronic
1184607268 22:45581360-45581382 GGAAGTGGTCACACACATGCTGG - Intronic
950164232 3:10781340-10781362 TGAAAGGGTAAGATTCATGAAGG - Intergenic
950981717 3:17314420-17314442 GTAAGTGATCAGATTTATGCAGG + Intronic
959233976 3:103693828-103693850 GGAAATTTTCACATGCATGCAGG + Intergenic
961096799 3:124163949-124163971 AGAAAAGGTTAGATTCAAGCTGG - Intronic
961438354 3:126934972-126934994 GGAAATGGTCACATCAATTCTGG + Intronic
962093270 3:132267684-132267706 GGAAAGGGTGACATTTATGCTGG + Intronic
967733888 3:192932102-192932124 GGAAAAGGTGACCTTCATGCTGG + Intergenic
967857528 3:194129627-194129649 TGAAAGGGTCAGAGCCATGCTGG - Intergenic
972224172 4:36993109-36993131 AGAAATGCATAGATTCATGCAGG - Intergenic
976392551 4:84520383-84520405 GGAAGTGGTCAAGTTCATGATGG - Intergenic
978977870 4:114901210-114901232 AGAAATGGACAGATTCATCAGGG - Intronic
981104382 4:140864162-140864184 GGTAATGATCAGAATCATGGAGG - Exonic
986588657 5:9346047-9346069 GGAAAAGGTAACATTCAAGCAGG - Intronic
993423944 5:87738705-87738727 GGAAAAAGTCAGATTCAAGTAGG + Intergenic
1000761587 5:165232107-165232129 GTCAATGGTCAGATAAATGCTGG - Intergenic
1001216675 5:169863001-169863023 GGAAAGGCTCAGATTCCTTCTGG - Intronic
1003424709 6:5990641-5990663 GGAAATGGAAAGATTGAGGCAGG + Intergenic
1003978717 6:11369129-11369151 GGAAATGGACAGATTCAAGAAGG - Intronic
1003996564 6:11547259-11547281 GGAATTGTTCACATTCATACTGG + Intronic
1004760855 6:18664452-18664474 GGAAATGATGAGATTCCAGCTGG - Intergenic
1005637406 6:27765238-27765260 GGAAATGTTCTGATTCCTGGTGG + Intergenic
1005813572 6:29533187-29533209 AGAAATGGTCAGGCTCCTGCAGG + Intergenic
1010165978 6:72915877-72915899 TGAAATGTTAAGATTCATGAGGG + Intronic
1010333973 6:74659683-74659705 GGAAATGGTTGGATTTCTGCTGG - Intergenic
1011294489 6:85811280-85811302 GGAAAAGGTAACATTCAAGCAGG + Intergenic
1013102350 6:106997670-106997692 GAAAATGATCATATTTATGCTGG + Intergenic
1016546972 6:145234824-145234846 GGAAATGGTCAAATTCAGGTAGG - Intergenic
1016559410 6:145378533-145378555 GGCCATGGTCATCTTCATGCTGG - Intergenic
1021137707 7:16986080-16986102 GATAATGGTCAGAGTCATCCCGG + Intergenic
1022093632 7:27124337-27124359 GGTAATGTTCTGATTCACGCTGG - Intronic
1028715291 7:93958639-93958661 GTAAATAGTCATATTCATCCTGG - Intergenic
1030199372 7:106886863-106886885 GGAGATGGACAGACTCATGTAGG - Intronic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1035152828 7:156889174-156889196 GGGAATAGTCAGATTCATATAGG + Intronic
1036475314 8:9087801-9087823 GGAAAGGGGCAGATTCAGGTAGG + Intronic
1038195194 8:25360664-25360686 GGAAATGCCCAGCTTCGTGCAGG + Intronic
1038403024 8:27299843-27299865 GGCAAAGGACAGATTCAGGCAGG + Intronic
1046549860 8:115702139-115702161 GTGTATGGTCAGATTCATGAAGG + Intronic
1056134683 9:83620686-83620708 GGAAATGGTCAGCTTCATACAGG + Intergenic
1056479750 9:86989397-86989419 GGACATGGTCAGATTCCAGATGG - Intergenic
1057009289 9:91587405-91587427 GGAAATGGTTAGAATCCTACTGG - Intronic
1059531486 9:115039538-115039560 GGAAATGGTCAGATTCATGCTGG - Intronic
1060960774 9:127679054-127679076 GGAAATGGTAAGATTCAAGAGGG - Intronic
1061765076 9:132876742-132876764 GGAAATGGTCAAAAACATGGAGG + Intronic
1061994803 9:134177935-134177957 GGGAATGGGGAGATTCTTGCTGG + Intergenic
1062631829 9:137466559-137466581 GGAAGTGGTCTGATCCGTGCCGG - Intronic
1187652114 X:21420706-21420728 GGCACTGGTCAGAGTCATGAGGG - Intronic
1188412556 X:29891550-29891572 GGATATGGTTATATTCATGTAGG + Intronic
1189478990 X:41378573-41378595 GAAAATGGTCACATTCAGCCAGG - Intergenic
1191652312 X:63552784-63552806 GGAAATGGTCAAATACATTGTGG - Intergenic
1194735547 X:97508854-97508876 AGAAATAGTTAGATTCAAGCTGG - Intronic
1195399574 X:104447201-104447223 GGAAATTTTCAGAGTCATGATGG + Intergenic
1196316368 X:114229632-114229654 GGAAATGGTAAAATTTATGAAGG - Intergenic
1198506861 X:137309539-137309561 GGAAATCTTCAGATTCAAGAAGG + Intergenic