ID: 1059532485

View in Genome Browser
Species Human (GRCh38)
Location 9:115048507-115048529
Sequence TAGGTTTTCCAGAAGGGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059532471_1059532485 29 Left 1059532471 9:115048455-115048477 CCGATGCCATCCAGGAAACTGTG 0: 1
1: 0
2: 2
3: 36
4: 455
Right 1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 187
1059532478_1059532485 3 Left 1059532478 9:115048481-115048503 CCGTAGGGATTAATGTCGGAAAT 0: 1
1: 0
2: 0
3: 8
4: 62
Right 1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 187
1059532473_1059532485 19 Left 1059532473 9:115048465-115048487 CCAGGAAACTGTGAACCCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 187
1059532472_1059532485 23 Left 1059532472 9:115048461-115048483 CCATCCAGGAAACTGTGAACCCG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 187
1059532477_1059532485 4 Left 1059532477 9:115048480-115048502 CCCGTAGGGATTAATGTCGGAAA 0: 1
1: 0
2: 1
3: 1
4: 50
Right 1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059532485 Original CRISPR TAGGTTTTCCAGAAGGGGCA GGG Exonic
901848582 1:12000525-12000547 TTGGATTACCAGAAGGGTCAAGG - Intronic
902200193 1:14827509-14827531 TTGCTTTTCCATTAGGGGCAGGG + Intronic
902409288 1:16203431-16203453 TAGATGCTCCAGAAGTGGCAGGG - Intronic
902710739 1:18238101-18238123 TGGGTTTTTCAGTTGGGGCATGG - Intronic
903348560 1:22703762-22703784 GGAGGTTTCCAGAAGGGGCATGG + Intergenic
903400015 1:23036279-23036301 TAGGTTTACCAGAAGTGACTAGG + Intronic
904052892 1:27650844-27650866 GAGGTATTCCTGGAGGGGCAGGG + Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905621508 1:39452153-39452175 TAGGTTTTCCAGAAGGAACTGGG + Exonic
907013036 1:50982121-50982143 TTGCTTTTCCATTAGGGGCATGG - Intergenic
908534530 1:65066280-65066302 TCGGTTTTCAGGAAGGGGGAGGG - Intergenic
909469850 1:76014563-76014585 TTGGTTTTCCAGATGGTGGAGGG - Intergenic
911064478 1:93775571-93775593 TATGTGTTCAAGAAGGTGCATGG + Intronic
911944288 1:104086518-104086540 TAGTTTTTAAAGAAGGGACAAGG + Intergenic
915699826 1:157781272-157781294 TGGGTTTTCCAGAAGGTGGATGG + Intergenic
916706841 1:167359353-167359375 TAGGGATTCCAAAAGGGGGAAGG - Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
918370313 1:183854334-183854356 CAGCTTTTCCTGAAGGGTCAGGG + Intronic
921259319 1:213371728-213371750 TATGTTATGCAGAAGTGGCAGGG - Intergenic
1062972460 10:1659689-1659711 TGGGTTGCCCAGATGGGGCAGGG - Intronic
1063427846 10:5963740-5963762 TACCTTTTCCAGAAGGGGAGAGG + Exonic
1065609405 10:27457161-27457183 TAGTCTTTACAGAAGGAGCAGGG + Intergenic
1065899623 10:30194067-30194089 TAGGATTTTCAGAATGGCCAAGG - Intergenic
1067394094 10:45896183-45896205 AAGATTTTCCAGAATGGGAAAGG - Intergenic
1067862419 10:49865320-49865342 AAGATTTTCCAGAATGGGAAAGG - Exonic
1067931969 10:50571016-50571038 TAGCTTATCCAGAAGGATCATGG - Intronic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1069869707 10:71525754-71525776 CAGGTTTCCCAGGAGGGTCACGG - Intronic
1070584067 10:77747806-77747828 TAGGGTGTCCGGAAGGGGAATGG + Intergenic
1070668509 10:78362092-78362114 TGGGTTTTCCAGGATGGGAAGGG + Intergenic
1070773235 10:79094940-79094962 TTTTTTTTCCAGGAGGGGCAGGG - Intronic
1073352897 10:102832410-102832432 TAGGTTGGCCAGCAGGGGCCGGG + Intronic
1074442950 10:113494813-113494835 TAGTTGTTCCAGCAGGGGAATGG - Intergenic
1075290615 10:121227350-121227372 TCCTTTTTCCAGAATGGGCAAGG - Intergenic
1075761668 10:124862234-124862256 GTGGTTTGGCAGAAGGGGCATGG + Intergenic
1078370011 11:10736584-10736606 GAGGTTAGCCAGAGGGGGCAGGG + Intergenic
1079155730 11:17946216-17946238 TAGGTTTTGCAGTAGGATCAGGG + Intronic
1081034863 11:38131340-38131362 TATGTTTGGCAGAAGTGGCATGG - Intergenic
1081822798 11:46016507-46016529 TAGGTCTTCTAGAATGGGTAAGG - Intronic
1083448739 11:62728187-62728209 TCGGTTTACCAGCAGGAGCAAGG - Intronic
1084359196 11:68658685-68658707 AATGTTTTCCAGAAAGGGCCAGG - Intergenic
1085626836 11:78080118-78080140 AAATCTTTCCAGAAGGGGCAGGG - Exonic
1086662728 11:89441346-89441368 TTGGTTTTCCAGAAGGTAGAAGG - Intronic
1086726887 11:90197297-90197319 TTCTTTTTCCAGAATGGGCAAGG - Intergenic
1089266617 11:117267821-117267843 TAGGTTCTACAGAAGTGCCAAGG - Intronic
1089281395 11:117377179-117377201 CAGTTTTTCCAGATGGGGCCAGG + Intronic
1089474822 11:118750811-118750833 TAGGTTTACCAGAGAGAGCAAGG - Exonic
1094135707 12:27123254-27123276 CAGGTCTTCCACAAGGTGCAGGG - Intergenic
1096464406 12:51840356-51840378 TAGGTTTTCCAGACTGCGAAAGG - Intergenic
1096773578 12:53951107-53951129 TAAGTTGCCCCGAAGGGGCAAGG + Intergenic
1096967672 12:55641388-55641410 TAGGCTTTCCACAAGGTGAAGGG - Intergenic
1098425652 12:70363604-70363626 TAGTTTTTCCAGTAGGATCATGG - Intergenic
1098641067 12:72839063-72839085 GAAGTGTTCCAGCAGGGGCAAGG - Intergenic
1100813973 12:98367651-98367673 TAATTTTTCCCCAAGGGGCAGGG - Intergenic
1101114807 12:101521705-101521727 TGGGTTTTCCAAAGTGGGCAAGG - Intergenic
1101843865 12:108346312-108346334 TACCTTTTTCAGAAGGGGCTGGG - Intergenic
1102050171 12:109856305-109856327 GAGCTTTTCCTCAAGGGGCAGGG + Intronic
1102182508 12:110923084-110923106 TAGGTTTTCCAGAGGGTAAAAGG + Intergenic
1102628332 12:114254531-114254553 CAGGTTTTCCTCAAGGGGAAGGG - Intergenic
1103208534 12:119149594-119149616 AAGGTTTTCCAGAAAGGGTGAGG + Intronic
1105657649 13:22458017-22458039 TATGTGTTCCAGGAGGGACATGG - Intergenic
1106620767 13:31368428-31368450 AAGATTTTCCAGACAGGGCAGGG + Intergenic
1108870165 13:54974923-54974945 TAGGTTTTCCAAAGGGGTCAAGG + Intergenic
1110391151 13:74975840-74975862 TAAGTTTTCCATCAGGGCCAGGG - Intergenic
1111801970 13:92992426-92992448 TAGCTGTTTCAGACGGGGCAAGG - Intergenic
1113658631 13:112088023-112088045 CTGGTTTTCCATAAGGGTCAAGG - Intergenic
1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG + Intronic
1114638943 14:24206199-24206221 GAGGTTTCTCAGAAGGGGTATGG + Intronic
1119182352 14:72613704-72613726 TGGGTTTTCTAGAAGGAACAGGG - Intergenic
1119567423 14:75640660-75640682 CAGCATTTACAGAAGGGGCAAGG - Intronic
1120384569 14:83827896-83827918 CAGGTGTTTCAGAAAGGGCAAGG - Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1128177934 15:65573143-65573165 CAGGTTTTCCATGAGGAGCAGGG - Intronic
1129329186 15:74818159-74818181 TTGGATTTACAGAAGGGGCCAGG - Intronic
1129533395 15:76289222-76289244 TAGGTGCTTCAGAATGGGCATGG - Intronic
1130918515 15:88324583-88324605 TATGTTTTCCAGAAGAGGAAAGG + Intergenic
1131378934 15:91948009-91948031 TAGGTGTTCCAGCAGGGCCGTGG + Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133372531 16:5256110-5256132 TAAGTTTTGCAGGAGGGGAAGGG + Intergenic
1134609447 16:15596802-15596824 GAGGTTTCCGAGGAGGGGCAGGG + Exonic
1135804544 16:25530834-25530856 TAGGTTTTGCAGGCTGGGCACGG + Intergenic
1136004683 16:27320712-27320734 TATGTTTTCCTGAAGCGGCCAGG + Intronic
1137315799 16:47321107-47321129 TAGATTTTCCAGATGGTGGAAGG - Intronic
1138093675 16:54195822-54195844 TTGCATCTCCAGAAGGGGCAGGG + Intergenic
1138359536 16:56415874-56415896 TATATTTTTCAGTAGGGGCAAGG - Intronic
1139370938 16:66469055-66469077 AAGGTTTCCCAGAAGAGGTAAGG - Intronic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139921478 16:70463293-70463315 GAGGTTCTCCATTAGGGGCAAGG - Intronic
1142133382 16:88441070-88441092 CAGGTTTTCCAGAAAGGGGCAGG + Intergenic
1143192143 17:5047816-5047838 TTGATTTTCTATAAGGGGCAAGG - Intronic
1144840096 17:18180827-18180849 AAGGTTTTCCAGAGGGGGAAGGG + Intergenic
1146277018 17:31522601-31522623 TAGGATTTGAAGAAGGGACAAGG - Intronic
1146568302 17:33932065-33932087 TAGGTTCCCCAGAATAGGCAGGG + Intronic
1147875126 17:43615589-43615611 TGGTTGTTCCAGCAGGGGCACGG + Intergenic
1148508490 17:48147601-48147623 GAGATTTTCCAGAAGGAGAAAGG + Intronic
1149388896 17:56170260-56170282 CAGGTATCCCTGAAGGGGCAGGG - Intronic
1149855655 17:60080113-60080135 AAGGTTTTCCCTAAGGGCCAAGG - Intergenic
1150299177 17:64034444-64034466 TGGATTTACCAGAAGGGGCCAGG + Intergenic
1151313514 17:73308704-73308726 GAGCTTTTCCAGAAGGGCCTTGG - Intronic
1152554384 17:81045749-81045771 TCGGTCTTCCAGGAGGGGCTGGG + Intronic
1155088771 18:22485429-22485451 TAGGTTTTCCAACTGGGGCAGGG + Intergenic
1155610593 18:27663035-27663057 TAGGAGTTTCAGAAGGGACAGGG - Intergenic
1158221384 18:55154345-55154367 TAGGTTTACGAGAGGAGGCAAGG + Intergenic
1158403491 18:57141277-57141299 AAGCTTTTCCGGAAGGGGGAAGG - Intergenic
1159446909 18:68552314-68552336 CAGGTATTCAGGAAGGGGCAGGG - Intergenic
1160235928 18:77087223-77087245 GGGGTTTTCCCTAAGGGGCAGGG - Intronic
1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG + Intronic
1162021686 19:7870964-7870986 TAGGTTCTCCAGAGGGGGTGTGG + Exonic
1162021702 19:7871033-7871055 TAGGTTCTCCAGAGGGGGTGTGG + Exonic
1164056658 19:21627776-21627798 TATGTTTTCAAGAAGGGGTCAGG - Intergenic
925023225 2:588011-588033 TGGGGCTTCCAGGAGGGGCAGGG + Intergenic
927911364 2:26902084-26902106 TAGGGTTTCCAGACGGTGCCAGG + Intronic
930426982 2:51224864-51224886 TAGCTTTTCCAGAAAATGCAAGG + Intergenic
934164919 2:89285260-89285282 TAGGGTTTCAGGAAGGGTCATGG + Intergenic
934202354 2:89897206-89897228 TAGGGTTTCAGGAAGGGTCATGG - Intergenic
934510427 2:94935315-94935337 AAGATTTTCCAGAACGGGAAAGG - Intergenic
936510579 2:113142053-113142075 TGAGTTTCTCAGAAGGGGCATGG - Intergenic
937077560 2:119118038-119118060 TAGGTGTTCAATAAGGGGAAAGG + Intergenic
938370753 2:130767036-130767058 GAAGTTTTCCTGAAGGGGAATGG - Exonic
938962597 2:136356655-136356677 TATTTTTCCCAGAAGGGGTAAGG - Intergenic
939010712 2:136842955-136842977 TACATTATTCAGAAGGGGCAAGG - Intronic
939126200 2:138180201-138180223 TAGGTTTGCCAGCAGGGAAAGGG + Intergenic
941011706 2:160307613-160307635 CAGGTTTTCCAAAAGGCCCAAGG + Intronic
944175212 2:196821198-196821220 TAGGGTGTCCAGAGGTGGCATGG + Intergenic
944599093 2:201285048-201285070 TGGGTTTTCCAGCAAGGGAAGGG - Exonic
946631568 2:221674702-221674724 GAGGTTTCCCAGAAGGGACGTGG + Intergenic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1171492673 20:25532298-25532320 TAGGATTTCCAGAAGAGGGAAGG + Intronic
1174165282 20:48579744-48579766 CAGTTTCTCCAGGAGGGGCAGGG + Intergenic
1175730311 20:61349816-61349838 TAAGTTTTCCAGGAGGGGAAAGG + Intronic
1178578849 21:33819343-33819365 TATGTTCTTCAGAAGGGTCAAGG + Intronic
1178855184 21:36244845-36244867 TAGGTTTTACAGAATGTTCAAGG - Intronic
1180122039 21:45759677-45759699 TTGGTTTTCCAGAAAGAGAAGGG + Intronic
1184151637 22:42643137-42643159 TAGTGTTTCCAGAAGGGGAGGGG - Intronic
1184633145 22:45802015-45802037 TAGGTTTTCCCAAAGGAGCTTGG + Intronic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
956703299 3:71977745-71977767 GAGGGTTTCAAGAGGGGGCAGGG + Intergenic
958573482 3:95917001-95917023 TTCGTTTTCCAGAAAGAGCAGGG + Intergenic
962920253 3:139943907-139943929 CAGGTTTATCAGAAGGGGTATGG - Intronic
964289049 3:155155172-155155194 TTTGTTTTCCAGAGGGGGAAGGG + Intronic
969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG + Intronic
972957885 4:44415217-44415239 AAGGTGTTCAAGAAGTGGCATGG + Intronic
973274006 4:48289986-48290008 TAGGTTTTCCTGAAGGGGTGGGG + Intergenic
975618748 4:76274687-76274709 TAGGTTTTCCAGGAGGAAGAAGG + Intronic
978017374 4:103762076-103762098 AAGGTTTTCTAAAAGGGCCAAGG - Intergenic
982641670 4:157969406-157969428 TATGTATTCCAGAAAGGCCATGG - Intergenic
983495740 4:168440575-168440597 AAGGTTTTCCAGAGAGGACATGG - Intronic
984972370 4:185203045-185203067 GAGTTTTGCCAGGAGGGGCATGG + Intronic
988483308 5:31647464-31647486 TAGAGCTTCCAGAAGGAGCACGG - Intronic
989967219 5:50478598-50478620 CAGGTTTTATAGAAGGGGGAAGG + Intergenic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
992488750 5:77220383-77220405 GAGATTTTCAAGAAGGGACAAGG + Intronic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
997025853 5:130060054-130060076 CAGGTTTTCCAGAAGGAGTTAGG - Intronic
1001272866 5:170328659-170328681 TAGTCATTCCAGCAGGGGCATGG + Intergenic
1005742658 6:28806970-28806992 CAGGATTTCCAGAAGAGCCAGGG + Intergenic
1007779373 6:44243947-44243969 TATGTCTTCCAGACTGGGCACGG - Intergenic
1008563043 6:52740542-52740564 TACATTTTCCACAAGGGCCAGGG + Intergenic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1009952884 6:70416874-70416896 TAGGTTTTTCAGAAGGAATAAGG + Intronic
1010043761 6:71417945-71417967 TAGGCTTTCCAGAAGTTGCCAGG + Intergenic
1013637600 6:112043927-112043949 TAGGTTTTGCAGAAGGCTAAAGG - Intergenic
1015212183 6:130710932-130710954 TAGATCCTCCAGGAGGGGCATGG - Intergenic
1015691031 6:135923029-135923051 GAGGTTTTCCAGAAGGTGGTTGG - Intronic
1016626728 6:146179260-146179282 TATCTTTTCCAGCGGGGGCATGG - Intronic
1016705012 6:147096719-147096741 TAGGTGTTCCAGAAGGGAAGGGG - Intergenic
1016900524 6:149096717-149096739 TGGGCTTACCAGAAGGAGCAGGG - Intergenic
1018019425 6:159745516-159745538 GAGGTTTTGCAGACAGGGCAGGG + Intronic
1021133077 7:16934644-16934666 AATGTTTTCTAGAAGGGGCATGG - Intergenic
1028035104 7:85972310-85972332 TAGGTCGTCCAGAAGAGTCAAGG + Intergenic
1028224080 7:88229539-88229561 TAGCTTTCCAAGATGGGGCAGGG - Intergenic
1028984360 7:96998223-96998245 AAGGTTTTCAAGAAGGGGGTGGG + Intergenic
1030677968 7:112404770-112404792 TGGGTTTTCCAGAATGCACATGG + Intergenic
1033738044 7:144244180-144244202 GAGGTATTGGAGAAGGGGCATGG - Intergenic
1033745011 7:144306777-144306799 GAGGTATTGGAGAAGGGGCATGG + Intergenic
1037722993 8:21460359-21460381 GAGATTTGGCAGAAGGGGCAGGG - Intergenic
1043645442 8:82511596-82511618 TAGGCTTTCCAGGAGGAACAGGG + Intergenic
1045821424 8:106342961-106342983 TAGGACTTCCAGTAGAGGCAAGG - Intronic
1046380216 8:113439761-113439783 TAGTTTCTCCAGAAGGGGTGGGG + Intergenic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1048186445 8:132246095-132246117 TTCGTTTTCCACACGGGGCATGG + Intronic
1051162645 9:14225674-14225696 TAAGTTTTCCAGCATAGGCATGG + Intronic
1052866939 9:33469659-33469681 TAGGATTTCCTGGAGGGGCCAGG + Exonic
1052956474 9:34256427-34256449 TGGGTTCTCCAGGAGGGACATGG + Exonic
1054529632 9:66167266-66167288 AGGGTTTTCCAGAACGGGAAAGG - Intergenic
1055527076 9:77145780-77145802 CAGGCTTTCCACATGGGGCATGG + Intergenic
1057575101 9:96236098-96236120 TAGAATTTCCAGACCGGGCATGG - Intronic
1057817086 9:98303746-98303768 TATTTTTTCCACAAGGAGCAAGG - Intronic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1059603357 9:115805928-115805950 TGGGGATTCCAGAAGGGGGAAGG + Intergenic
1060404853 9:123368168-123368190 CAGGCATTCCAGAGGGGGCAGGG - Intronic
1061660278 9:132125510-132125532 CAGGTTTTCCAGGAGGTGCGGGG - Intergenic
1186316665 X:8378154-8378176 AAGGTTTTCCAGGAATGGCAAGG + Intergenic
1188506852 X:30892225-30892247 TAGGTATTCCACAAGAGACAGGG - Intronic
1188765892 X:34089978-34090000 ACTGTTTTCCAGAAGTGGCATGG - Intergenic
1192156878 X:68753372-68753394 TAGGTTTTCTGGAAGGAGCCTGG - Intergenic
1192359032 X:70426826-70426848 CAGGCTTTCAAGAATGGGCAAGG - Intronic
1192724294 X:73731510-73731532 TAGGGACTCCAAAAGGGGCAAGG - Intergenic
1192848483 X:74929274-74929296 TAGTTTTTCCATAGGGGGCATGG + Intergenic
1193059588 X:77190881-77190903 TAGGTATTCCAAAAGGGGGAAGG - Intergenic
1194440814 X:93931629-93931651 TAGTGTTTCCAAAAGGGGAAAGG - Intergenic
1195726471 X:107922576-107922598 TTGGTTATCCACAAGGGGTAGGG - Intronic
1198061591 X:133051023-133051045 TAGATTTTCCAGAACTGTCAAGG - Intronic
1200153929 X:153965273-153965295 TAGGTGTGGCAGCAGGGGCAGGG - Intronic