ID: 1059534804

View in Genome Browser
Species Human (GRCh38)
Location 9:115070599-115070621
Sequence CCAATCCATCAGTAAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059534800_1059534804 7 Left 1059534800 9:115070569-115070591 CCACATCAAGAAAAAGACTTACA 0: 1
1: 0
2: 0
3: 31
4: 321
Right 1059534804 9:115070599-115070621 CCAATCCATCAGTAAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059534804 Original CRISPR CCAATCCATCAGTAAAACCC TGG Intronic
No off target data available for this crispr