ID: 1059535147

View in Genome Browser
Species Human (GRCh38)
Location 9:115073738-115073760
Sequence CAGTCTCCCCACAGGCCAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059535147_1059535156 28 Left 1059535147 9:115073738-115073760 CCCACTGGCCTGTGGGGAGACTG 0: 1
1: 0
2: 1
3: 20
4: 228
Right 1059535156 9:115073789-115073811 CCAACGGTGTCTTCCAGAGCAGG 0: 1
1: 0
2: 2
3: 10
4: 102
1059535147_1059535154 12 Left 1059535147 9:115073738-115073760 CCCACTGGCCTGTGGGGAGACTG 0: 1
1: 0
2: 1
3: 20
4: 228
Right 1059535154 9:115073773-115073795 TAGCGGTCAAATTTGGCCAACGG 0: 1
1: 0
2: 0
3: 4
4: 47
1059535147_1059535153 5 Left 1059535147 9:115073738-115073760 CCCACTGGCCTGTGGGGAGACTG 0: 1
1: 0
2: 1
3: 20
4: 228
Right 1059535153 9:115073766-115073788 GAGGCGGTAGCGGTCAAATTTGG 0: 1
1: 0
2: 0
3: 4
4: 29
1059535147_1059535152 -5 Left 1059535147 9:115073738-115073760 CCCACTGGCCTGTGGGGAGACTG 0: 1
1: 0
2: 1
3: 20
4: 228
Right 1059535152 9:115073756-115073778 GACTGTAATTGAGGCGGTAGCGG 0: 1
1: 0
2: 1
3: 3
4: 59
1059535147_1059535157 29 Left 1059535147 9:115073738-115073760 CCCACTGGCCTGTGGGGAGACTG 0: 1
1: 0
2: 1
3: 20
4: 228
Right 1059535157 9:115073790-115073812 CAACGGTGTCTTCCAGAGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059535147 Original CRISPR CAGTCTCCCCACAGGCCAGT GGG (reversed) Exonic
900210797 1:1454887-1454909 CAGTGTCTCCACAGGTCACTCGG + Intronic
900489740 1:2941912-2941934 CAGTCTCCTCACAGCCATGTGGG + Intergenic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
900832160 1:4973153-4973175 CAGAGTCCCCACAGCCCATTCGG + Intergenic
902962524 1:19974947-19974969 CTTTCTCCCAGCAGGCCAGTAGG + Intergenic
904369144 1:30037589-30037611 CAGACTCCACATAGGCCAGCAGG - Intergenic
905299335 1:36975805-36975827 CTGTTTCCCCACTGGCCTGTAGG + Intronic
907792657 1:57682601-57682623 CATTCTCACCACAGACCACTGGG + Intronic
909350060 1:74641395-74641417 CTGTCTCCCCACCCACCAGTTGG - Exonic
912223899 1:107709205-107709227 CACCCTCCACACAGGTCAGTGGG - Intronic
915087187 1:153396820-153396842 CAGGCTCCCCACTGCCCACTGGG + Intergenic
917537967 1:175888131-175888153 CAGTATCTCCAAAGGCCACTAGG - Intergenic
919356326 1:196527114-196527136 CAGTTTTCCCATAGACCAGTGGG - Intronic
920647403 1:207813690-207813712 CAGGCTCCGCACAGGCCATGGGG + Intergenic
922684738 1:227630366-227630388 CAATTCCCCCACAGGCCAGCAGG - Intronic
923779453 1:237009160-237009182 CAGTCTCCCCAAAGGCCTGGAGG - Intergenic
1063602262 10:7493044-7493066 CAGGCTCACCACACTCCAGTGGG + Intergenic
1066305021 10:34132402-34132424 CACTTTCCCCACTGGCCAGCTGG - Intronic
1069822417 10:71235907-71235929 CAGGCTCCTGACATGCCAGTGGG - Intronic
1070510555 10:77156956-77156978 CAGTCTCCCCAAAGGCTAGGAGG - Intronic
1074982780 10:118633140-118633162 CTGTCTCCCAACAAGCCTGTGGG + Intergenic
1075664779 10:124222512-124222534 CAGGCTGCTCACAGTCCAGTGGG + Intergenic
1076521668 10:131085111-131085133 CTGTGTCCCCACAGGGCAGAGGG - Intergenic
1077019269 11:410325-410347 CTGTCTCCCGACATGGCAGTTGG + Intronic
1077035990 11:494775-494797 CAGGCTGCACACAGGCCAGAAGG + Exonic
1077337645 11:2012568-2012590 CAGTCACGCCACAGGCCAGGTGG - Intergenic
1081585070 11:44378642-44378664 CACTCTCCTCACAGGGCATTTGG + Intergenic
1083307641 11:61769479-61769501 CAGGCTCCCCACCCGCCCGTGGG - Intronic
1083628842 11:64085629-64085651 CAGCCTCCCCACAGCCATGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084529720 11:69719721-69719743 CAGCCTCTCCTGAGGCCAGTGGG + Intergenic
1084647729 11:70469039-70469061 CAGTCTCCCCACACCCCAGCAGG - Intronic
1084943871 11:72628647-72628669 CAGTCTCCTCACCTGCCAGGCGG - Intronic
1084983226 11:72844408-72844430 CAGTCTCCACACAGTTAAGTTGG - Intronic
1085388548 11:76170769-76170791 CAGCCTCACCACAGGCCACAGGG - Intergenic
1085523893 11:77153441-77153463 CACTCTGCCCACAGCCCAGAGGG - Intronic
1086742482 11:90384778-90384800 CTGTCTCCCCACTGGCCACAGGG + Intergenic
1089376923 11:118000904-118000926 CTGCCTCCCCATAGGCCATTTGG + Exonic
1090013018 11:123061997-123062019 CAGCCTCCACACAGGCCTGTTGG - Intronic
1202820629 11_KI270721v1_random:67750-67772 CAGTCACGCCACAGGCCAGGTGG - Intergenic
1092083228 12:5735309-5735331 CAGTCTCCCCAGGAGCCAGCTGG + Intronic
1093655367 12:21688057-21688079 CAGTGTCCACACATGCCAGAGGG - Intronic
1095918475 12:47504693-47504715 CACTTTCCCCAGAGGCCAGGTGG - Intergenic
1098872450 12:75832404-75832426 CAGACTTCACACAGGACAGTAGG - Intergenic
1099834931 12:87896997-87897019 AAGTCTCCCTACAGTGCAGTTGG + Intergenic
1100270455 12:93019719-93019741 CAGGCTTCCCACAGCCCAGGAGG + Intergenic
1101138427 12:101770020-101770042 CAGTCACTCCAAAGGCCAGAAGG - Exonic
1102200704 12:111055777-111055799 CAGCCTCCCTACAGGTAAGTAGG + Intronic
1102254989 12:111410056-111410078 CCGGCTCCCCACTGGCCAGCCGG - Intronic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1103854542 12:123957281-123957303 CAGGCTCCTGACTGGCCAGTAGG - Intronic
1104368349 12:128198518-128198540 AAGTCTCCCCACAGGGGTGTGGG + Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1107996235 13:45864072-45864094 CAGCCTCCACACAGCCCGGTTGG + Intergenic
1109763369 13:66860665-66860687 CAGTCTCACAACAGGACACTGGG - Intronic
1112361092 13:98719261-98719283 CAGGAACCCCAAAGGCCAGTGGG + Exonic
1116313949 14:43362594-43362616 CAGTTTCCTAACAGGCCAATGGG - Intergenic
1119398802 14:74348454-74348476 CCGCTTCCCCACCGGCCAGTTGG + Exonic
1121565363 14:94905479-94905501 CAGTCTCCCCAGAACCCAGCTGG - Intergenic
1122038509 14:98965290-98965312 CAGGCTCACCACAGGCAGGTGGG + Intergenic
1122120808 14:99552495-99552517 CAGTGTCCCCTCAGTCCGGTGGG + Intronic
1122738586 14:103857735-103857757 CAGTGTCCACACATGCCAGAAGG - Intergenic
1122781675 14:104146404-104146426 CCCTCTCCCCACAGGCCTCTAGG - Intronic
1122847511 14:104507973-104507995 CAGAGTCCCCACAGGCCTGCAGG + Intronic
1122858347 14:104570902-104570924 CCCTCTCCCCACAGGCCCGGAGG + Intronic
1122892562 14:104739566-104739588 CAGTCTCCCCACCTGCAAATGGG - Intronic
1123891633 15:24786324-24786346 CAGGCTCACAACAAGCCAGTAGG + Intergenic
1124136860 15:27042695-27042717 CAGTCTCTCCACATGCCCTTGGG + Intronic
1127669445 15:61181131-61181153 CAGTCACCTTACAGGCCAATAGG + Intronic
1128440001 15:67697972-67697994 CAGTCTCCTCACTGGTCAATGGG - Intronic
1129451603 15:75654334-75654356 AGGTCTCCCCACTGCCCAGTGGG - Intronic
1129614944 15:77091008-77091030 CACTTTCCCCAAAGGCCAGATGG - Intergenic
1129663600 15:77567035-77567057 CAGTATCGACACTGGCCAGTGGG - Intergenic
1129698174 15:77752481-77752503 CAGCCTCCCCACAGGGCTCTGGG + Intronic
1131439064 15:92444935-92444957 CGGCCTCCCTACAGGCCAGTAGG + Intronic
1131760425 15:95616736-95616758 CATTCTCCCCACAGGGTAATAGG - Intergenic
1132999569 16:2842134-2842156 ATGTCTCCACACAGGCCAGCCGG + Intergenic
1133475829 16:6121100-6121122 CACACTCCCAACAGGCCAGTTGG - Intronic
1136414068 16:30092836-30092858 CAGTCTCACCACAAGGCACTGGG + Intronic
1136487941 16:30585330-30585352 CGGTGTCCCCAGAGGCTAGTGGG - Intronic
1138554344 16:57763119-57763141 CTGTCTCCCCACAGCCAGGTTGG + Intronic
1139675060 16:68517789-68517811 CTGTCTCCTCCCAGGCCACTCGG - Intergenic
1140274051 16:73492836-73492858 CAGTCTCACCACAGTCCGCTAGG - Intergenic
1141895120 16:86954274-86954296 GAGCCTCCACACTGGCCAGTGGG + Intergenic
1142188703 16:88707059-88707081 CTGTCTCCCCAAAGCCCACTAGG + Intronic
1142441788 16:90103188-90103210 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
1142675322 17:1509684-1509706 CAGTACCCAAACAGGCCAGTGGG + Exonic
1142997346 17:3768774-3768796 CTGTCTCCCCACGAGACAGTAGG + Intronic
1148197851 17:45727620-45727642 CACTTTCCCCACATGCCAGCTGG + Intergenic
1148621108 17:49035569-49035591 CAGTCTCCCCACACACATGTGGG + Intronic
1149001166 17:51759088-51759110 CAGGCTCTCCACATGCTAGTGGG - Intronic
1149009111 17:51836551-51836573 GGGGCTCCCCACAGGCGAGTGGG - Intronic
1149394175 17:56221959-56221981 AAGTTTCCACACAGGGCAGTAGG - Intronic
1152821217 17:82438839-82438861 CTGTATCCCAACAGGACAGTGGG - Intronic
1154146786 18:11873547-11873569 CAGTCTCCGCACCCGCCAGAGGG + Intronic
1155267278 18:24106221-24106243 GTGTCTCCCCACAGGCAACTGGG + Intronic
1157151564 18:45223669-45223691 CTGTGTCCCCACTGGTCAGTGGG - Intronic
1158962917 18:62601378-62601400 GAGTCTCCCCACAGCTCAGGGGG + Intergenic
1159511232 18:69400776-69400798 CAGCCACCCCACGGGCCAGGGGG + Intergenic
1159775637 18:72600738-72600760 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1161283993 19:3459567-3459589 CAGTCTCCCCTCAGCTGAGTGGG + Intronic
1161717787 19:5886568-5886590 CAGTTTCCCCATAGGCCAAATGG + Intronic
1162497320 19:11030577-11030599 CACTCTCCACACGGGCCTGTGGG - Intronic
1162524465 19:11199391-11199413 TGGTCACCCCACAGCCCAGTGGG + Exonic
1163148304 19:15397107-15397129 CAATCTACCCACAGGACAGAGGG + Intronic
1163155920 19:15439922-15439944 CACACTCCCCGCAGGCCAGCGGG + Intronic
1163459168 19:17425932-17425954 CAGTCTCCCTACAACCCACTGGG + Intronic
1164565746 19:29324619-29324641 CACTCTCCCCACAGCCAGGTGGG + Intergenic
1164675401 19:30097199-30097221 CTGTCACCCAGCAGGCCAGTGGG - Intergenic
1165060720 19:33204094-33204116 CAGTTTCCCCAAGGGCCAGGTGG + Intronic
1165154391 19:33778294-33778316 CAGCCTCCCCACCGCGCAGTCGG + Intergenic
1165936035 19:39389624-39389646 CTGTCTCCCCACACACCATTGGG + Exonic
925029161 2:636355-636377 CAGCAACCCCACAGGCCCGTGGG + Intergenic
925223206 2:2159568-2159590 CAATCTCAACACAGGCCTGTGGG - Intronic
927077264 2:19591155-19591177 CACTCTCCCAACAGGGCAATTGG + Intergenic
927484160 2:23477532-23477554 CAGCCTCCCAGCAGCCCAGTGGG + Intronic
931083950 2:58808051-58808073 AAGTTTCCTCACAGGCCGGTGGG - Intergenic
931412332 2:62045087-62045109 CAGTCTCCCCAAAGGCCTGCAGG + Intronic
934559391 2:95304810-95304832 CTGGCTCCCCACAGGCCAGGAGG + Intronic
937835366 2:126465963-126465985 CAGCCTCCTCACTGGCCAGGAGG + Intergenic
939619579 2:144402014-144402036 CAGTTTTATCACAGGCCAGTAGG + Intronic
944314112 2:198267130-198267152 CAGTCTCCCCAGAGGCTTGAAGG + Intronic
946071404 2:217037206-217037228 CACTCTCAGCACAGGCCTGTGGG - Intergenic
947593916 2:231399352-231399374 CAGTCTCCCCAGAGGCCGGGCGG + Exonic
947810565 2:233001396-233001418 GAGTCTCCCCACGGGCCCATAGG + Intronic
1169907371 20:10617379-10617401 CAGTCTTCCCACTGGCCTGCGGG + Intronic
1170590148 20:17765451-17765473 CAGCCTCCGGAGAGGCCAGTAGG + Intergenic
1172133588 20:32672829-32672851 CTGTCTTCCCACAGGGCTGTGGG + Intergenic
1173706562 20:45114509-45114531 CAGTCACACCACAGCCCAGCAGG + Intronic
1174362545 20:50038034-50038056 CTGTCTCCCCACTGGAAAGTGGG + Intergenic
1175652084 20:60734178-60734200 CAGGCTCCACCCAGGCCGGTTGG + Intergenic
1175933863 20:62506186-62506208 GAGTCTCCCCACAGGACCCTGGG - Intergenic
1176022231 20:62967717-62967739 CAGTTTCCCCACCTGCCAGCGGG + Exonic
1176167446 20:63681533-63681555 CAAGCACCCCACAGGCCAGATGG - Intronic
1177032863 21:16004409-16004431 CAATCTTCCCACAGGCTACTTGG + Intergenic
1177816423 21:25982258-25982280 CAGTCTCCCCACAGGCCTGCTGG - Intronic
1177905991 21:26971911-26971933 CAGTCTCACCCCTGGCAAGTAGG + Intergenic
1177920330 21:27143869-27143891 CAGGCTCCCCGCCGGCCAGCGGG + Intergenic
1179048299 21:37866602-37866624 CATTCTCCCCAGTTGCCAGTAGG - Intronic
1179668866 21:42931490-42931512 CAGTCTCCCCAGAGGCTTGCAGG - Intergenic
1179836317 21:44036281-44036303 CAGCCTCCCCACAGTCCTGAGGG + Intronic
1180836846 22:18934228-18934250 GAATCTCCCCACAGCCCAGAGGG + Intronic
1181316419 22:21973590-21973612 CCGGCTCCCCACCTGCCAGTTGG + Intronic
1181331798 22:22098587-22098609 AGGTCTCCCCACAGGACAGCAGG + Intergenic
1181437806 22:22920504-22920526 CACTCACCCCACAGGCCAGCTGG + Intergenic
1181475772 22:23167016-23167038 CAGTCTCCCCACCTGTCAGGCGG - Intergenic
1181875340 22:25936065-25936087 CTGTCTCCCCACTGGACACTGGG - Intronic
1182308464 22:29388128-29388150 GAGTTTTCCCTCAGGCCAGTGGG + Intronic
1184130146 22:42512753-42512775 CAGAGTCCACACAGGCCAGGAGG - Exonic
1184480532 22:44744328-44744350 AAATCACCCCACAGGACAGTGGG + Intronic
1184859467 22:47165045-47165067 CAGCCTCTCCACAGGGCAGGGGG + Intronic
1185136341 22:49075316-49075338 CAGTCCAGCCACGGGCCAGTGGG + Intergenic
1185330238 22:50249096-50249118 CAGTCACCTCAAAGGCCAGTGGG + Exonic
1203286939 22_KI270734v1_random:159527-159549 GAATCTCCCCACAGCCCAGAGGG + Intergenic
949397351 3:3629153-3629175 CAGACTCCCCAGAGGACAGTTGG + Intergenic
950211236 3:11125109-11125131 CAGTTTCCCAAAAGGCCAGGTGG - Intergenic
954249681 3:49358191-49358213 CAGGCTCCCCGCCGGCCAGCGGG + Exonic
954645683 3:52130275-52130297 CACTCACCCCAGAGGCCTGTTGG - Intronic
958864631 3:99486303-99486325 CAGTCCCACTCCAGGCCAGTGGG + Intergenic
959350473 3:105255904-105255926 CAGGCTCCCCAGGGGACAGTTGG - Intergenic
961167019 3:124770387-124770409 CTGTGCCCCCACAGGCCTGTGGG + Intronic
961330763 3:126136678-126136700 CAGGACCCCCAGAGGCCAGTGGG + Intronic
961817813 3:129560294-129560316 CAGTCTCCCCTCTGTGCAGTGGG - Intronic
968290405 3:197534712-197534734 CAGTTTCCCCACAGCCTTGTCGG + Intronic
968362053 3:198154155-198154177 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
970270865 4:14345934-14345956 CGGTCTCCCCACTGGAGAGTGGG + Intergenic
971401021 4:26275424-26275446 ATGCCTCCCAACAGGCCAGTGGG + Intronic
972708048 4:41564909-41564931 CAAACTCCTCACAGGGCAGTAGG - Intronic
974450335 4:62048079-62048101 CAGTCTCCTCCCAGGGCTGTTGG + Intronic
974979009 4:68929893-68929915 CAGTTGCCACACAGGCCAGCAGG + Exonic
974984524 4:69004936-69004958 CAGTTGCCACACAGGCCAGCAGG + Intronic
975011407 4:69358077-69358099 CAGTTGCCACACAGGCCAGCAGG - Intronic
975020438 4:69480711-69480733 CAGTTGCCACACAGGCCAGCAGG + Exonic
976164508 4:82240021-82240043 CAGTCACCCCAAGGGCCAGAGGG + Intergenic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
977761117 4:100738493-100738515 CACTCTCCCCAAAGGCAGGTTGG - Intronic
980745471 4:137007364-137007386 CACCCTCCCCAGAGGCCAGGAGG - Intergenic
980819426 4:137994387-137994409 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
984765099 4:183394290-183394312 CCCACTCCCCACAGGCCAGCGGG + Intergenic
984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG + Intronic
985081120 4:186265050-186265072 GAGTCTTCCCACTGGACAGTGGG - Intergenic
985361978 4:189185160-189185182 AAGTCCCCCCACAGGACAGAGGG + Intergenic
987152614 5:15057394-15057416 CAGTAGCCCCACAGGCCACGGGG + Intergenic
991645844 5:68799592-68799614 CAGGCTGCCCACTGGCCAGCAGG - Intergenic
992056393 5:72995643-72995665 CAGACTCCCCACAAGCAAGAAGG - Intronic
992260857 5:74968487-74968509 CAGTGTCCACACTGGCCCGTGGG + Intergenic
995658494 5:114453971-114453993 CTGTCTCACCACACCCCAGTAGG + Intronic
997646435 5:135485039-135485061 CAGTCTGCCCAGAGGCCACCTGG - Intergenic
998107633 5:139478401-139478423 CAGGCACCCCACAGTCCAATGGG + Exonic
1000017800 5:157293807-157293829 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1001447246 5:171794999-171795021 CAGAGTCCCCACAGGTGAGTGGG + Intergenic
1002059555 5:176618516-176618538 GAATCTCCCCACAAGCCAGATGG + Intergenic
1006399204 6:33806586-33806608 CAGTTTCCCCACATGTAAGTTGG - Intergenic
1006732104 6:36243932-36243954 CAATCTCCCAACAGTCCAGGTGG + Intronic
1007109225 6:39303524-39303546 CAGCCTCCCCAGAGCCCTGTGGG - Intronic
1008428559 6:51387967-51387989 CAGTCTACACATTGGCCAGTCGG + Intergenic
1011656438 6:89556099-89556121 CAGTCTGCCCCCTGGCAAGTGGG + Intronic
1013431677 6:110061847-110061869 GAGTCCCCCAACAGGCCAGTGGG - Intergenic
1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG + Intergenic
1017084994 6:150705522-150705544 CAGTCGCCCCACCTGCCAGGAGG + Intronic
1017863219 6:158418512-158418534 CAGTCTCCCAACTAGCCACTTGG - Intronic
1018149392 6:160924371-160924393 CACTGACCCCACTGGCCAGTGGG - Intergenic
1018378917 6:163240183-163240205 CACTCACCCCACAGGCCCGGCGG - Intronic
1018445574 6:163855152-163855174 CAGTCTCAGCACAGCCCAGGGGG - Intergenic
1019253627 7:34552-34574 CGGTCTGCCCAGAGGCCAGCAGG - Intergenic
1023097023 7:36671791-36671813 TAGTCTCCCCACACACCAGGAGG - Intronic
1023767194 7:43522644-43522666 CAGTCCTCCCACAGGCCAAGAGG + Intronic
1023931212 7:44707770-44707792 GACCCTCCCCTCAGGCCAGTAGG + Intronic
1024580842 7:50799639-50799661 CAGTCTCCCAACTGGTCTGTTGG - Intergenic
1027358873 7:77387584-77387606 CAGTCTCCTCACAGGACTCTAGG - Intronic
1028875602 7:95819711-95819733 CAGTCTCCCCAAAGTCGAATTGG - Intronic
1032878093 7:136059229-136059251 CAGTCTCCCCACAGACTTGCTGG - Intergenic
1035625114 8:1065893-1065915 CATTCTCCCCACAGACCACGCGG - Intergenic
1036644375 8:10602547-10602569 TAGTCTCCCCAAGGGACAGTGGG - Intergenic
1037570960 8:20157382-20157404 ACGATTCCCCACAGGCCAGTAGG + Intronic
1038312325 8:26454038-26454060 CAGTCTCTCTACAAACCAGTCGG - Intronic
1040855900 8:51947783-51947805 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
1046232423 8:111374484-111374506 ATGTCTCCACACAGGCCAGGTGG + Intergenic
1047311216 8:123694030-123694052 CAGTCTGCTCAGAGGTCAGTGGG - Intronic
1047399309 8:124532699-124532721 CCGTTTCACCCCAGGCCAGTAGG + Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049079129 8:140427965-140427987 CAGTCTCCCCATAGGCAGGGAGG - Intronic
1049447384 8:142637589-142637611 CAGTCTCCCCATGGCCCAGCTGG + Intergenic
1049709998 8:144059165-144059187 CTGTGTCCCAACAGGCCGGTCGG + Intronic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1051349636 9:16186752-16186774 CTGTCTCCTCAAAGGCCTGTTGG - Intergenic
1054906011 9:70413999-70414021 CACCCTCCCCACTGGCCAATTGG - Exonic
1057606565 9:96502083-96502105 TAGTCTGCCCACAGCCAAGTGGG + Exonic
1059320431 9:113464300-113464322 CAGCCTCCCCACAAGGCAGCAGG - Intronic
1059535147 9:115073738-115073760 CAGTCTCCCCACAGGCCAGTGGG - Exonic
1060531002 9:124346937-124346959 AAGCCTCGCCACAGGCCTGTGGG + Intronic
1061834597 9:133320578-133320600 CAGGCTCAGCACAGGCCAGGCGG - Intergenic
1062220563 9:135412964-135412986 CAGTTTCCCCACAGCCGAGAAGG - Intergenic
1062600584 9:137317117-137317139 CAGCCTCCTCACAGGCCGGCTGG - Intronic
1062746741 9:138217817-138217839 CGGTCTGCCCAGAGGCCAGCAGG + Intergenic
1186490448 X:9968211-9968233 AAGTCTTCCCACCTGCCAGTTGG + Intergenic
1186829844 X:13379259-13379281 CAGGCTCCCCGCCGGCCAGCGGG + Intergenic
1187301460 X:18054581-18054603 CTGTGTCCCCACAGTACAGTGGG - Intergenic
1187817459 X:23248190-23248212 CAGTCTACCCACAAACCCGTGGG - Intergenic
1188034790 X:25305349-25305371 CAGCCTCCCCACAGGCTGTTAGG + Intergenic
1189064913 X:37797094-37797116 CACTCTGCCCAGAGCCCAGTTGG + Intronic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1198791900 X:140355123-140355145 CCGTCTCCCCACACACCAGGTGG + Intergenic
1199950257 X:152700754-152700776 CCCTCTCTCCCCAGGCCAGTGGG + Exonic
1199959421 X:152767707-152767729 CCCTCTCTCCCCAGGCCAGTGGG - Exonic
1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG + Intergenic
1202171349 Y:22047967-22047989 CTGTTTCACCACAGTCCAGTTGG - Intergenic
1202220013 Y:22538405-22538427 CTGTTTCACCACAGTCCAGTTGG + Intergenic
1202323103 Y:23657261-23657283 CTGTTTCACCACAGTCCAGTTGG - Intergenic
1202547669 Y:26012793-26012815 CTGTTTCACCACAGTCCAGTTGG + Intergenic