ID: 1059536189

View in Genome Browser
Species Human (GRCh38)
Location 9:115083279-115083301
Sequence ATGTTATTATTAAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059536185_1059536189 20 Left 1059536185 9:115083236-115083258 CCTGGTTCGTGGCATGCAGAACA 0: 1
1: 0
2: 1
3: 21
4: 320
Right 1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059536189 Original CRISPR ATGTTATTATTAAGGAAAAA AGG Intronic
No off target data available for this crispr