ID: 1059538897

View in Genome Browser
Species Human (GRCh38)
Location 9:115111333-115111355
Sequence CTGTGTAACCTAATCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059538897 Original CRISPR CTGTGTAACCTAATCATGGA AGG (reversed) Intronic
902687902 1:18090884-18090906 TTTTGTAACCTAATCCTAGAAGG + Intergenic
903853640 1:26322566-26322588 CTTTGGAAGCCAATCATGGAAGG - Intronic
908127369 1:61044366-61044388 CTGAGTAAACAAATCAAGGATGG + Intronic
909208378 1:72790570-72790592 CTGTGGAACTTAATCAGGCAAGG + Intergenic
910070094 1:83203232-83203254 ATGAGTAACCTAATAATGTAGGG - Intergenic
910298150 1:85673817-85673839 CTCTGTAACATACTCATGAATGG - Intronic
911118407 1:94270658-94270680 CTGTTTAAGCTGATCATGTAGGG - Intronic
912547984 1:110465131-110465153 CTTTGAAACCTAATTCTGGATGG - Intergenic
916191532 1:162183642-162183664 CTCTGTAACATAAAAATGGAAGG - Intronic
918213835 1:182375697-182375719 CTTTATAAGCTAATCTTGGAAGG - Intergenic
919025320 1:192161665-192161687 CTGGCTAACCTCATCTTGGAAGG - Intronic
922085527 1:222343338-222343360 CTGTGTTACTGAAGCATGGAAGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1071079621 10:81795247-81795269 CTTTGTAACCTAATAATTGCTGG + Intergenic
1076385520 10:130052321-130052343 CTGGGCCACCCAATCATGGAGGG + Intergenic
1080794682 11:35552539-35552561 CTGTGTGACCAAATTTTGGAGGG - Intergenic
1085566136 11:77515439-77515461 CCATGTAACCAAATCATGCACGG - Intronic
1088338651 11:108737974-108737996 CTGTGATACCTAATTTTGGAAGG + Intronic
1090335644 11:125961613-125961635 ATATGTAAACTAATCATAGAGGG + Intronic
1096475031 12:51903931-51903953 GTGTGTATTCTTATCATGGATGG - Intergenic
1098651316 12:72973539-72973561 CTGTGTCATCTTATCATGGAAGG - Intergenic
1102973066 12:117186480-117186502 GTGTGTATCCTAAATATGGAAGG - Exonic
1109184972 13:59257555-59257577 CTGTGGAACCTAATCACTCATGG + Intergenic
1110998359 13:82142620-82142642 TTTTATAACCCAATCATGGATGG + Intergenic
1111005717 13:82245606-82245628 CTGTGTTAGCTAATCATAGTAGG - Intergenic
1112601046 13:100856410-100856432 CTGAGTGACATTATCATGGAAGG + Intergenic
1114336407 14:21695372-21695394 CTTTGGAACATAATCATGAAAGG + Intergenic
1118966111 14:70587186-70587208 CTGTGTAACCTCTTAAGGGAAGG + Intronic
1120384308 14:83824901-83824923 ATGTGTAATTGAATCATGGAGGG - Intergenic
1120766854 14:88335745-88335767 CTTTGAAAACTGATCATGGAGGG + Intergenic
1121281615 14:92703163-92703185 GTGTATCCCCTAATCATGGAAGG + Intergenic
1121788736 14:96682717-96682739 ATAAGTAACCTAATCATGGCAGG - Intergenic
1124353205 15:28974994-28975016 CTGTCTAAGCTAATCATGAAGGG + Intronic
1124972749 15:34505578-34505600 CTGTGTAACATTGTCATGGTGGG - Intergenic
1125855314 15:42943004-42943026 TTGTATAACTTCATCATGGATGG + Exonic
1127334495 15:57970307-57970329 CTGTGTACCCCAAACATGCAAGG + Intronic
1130852510 15:87809190-87809212 CTGTTTAGCCTAAAAATGGAAGG - Intergenic
1132071921 15:98785958-98785980 CTGTCTAATCCAATTATGGATGG + Intronic
1132187650 15:99816079-99816101 CTGTGTAACATTGTCATGGTGGG + Intergenic
1146938752 17:36828782-36828804 ATGTTTAACCTGACCATGGAGGG - Intergenic
1151881510 17:76898159-76898181 CTATGTAACCTAATCTTGGTAGG - Intronic
1154207095 18:12346611-12346633 CTGAGTAACATAATGATCGATGG - Intronic
1158056979 18:53292869-53292891 CTGTGAAACCCAATCATGTGAGG + Intronic
1162666984 19:12221910-12221932 CTGTGGAAGGAAATCATGGATGG - Intergenic
1165354242 19:35293887-35293909 CTGTGAAACCCAGTCATTGATGG + Intronic
932100021 2:68890124-68890146 CTGCATAACCCATTCATGGAGGG - Intergenic
935889057 2:107655907-107655929 TTTTGTAATTTAATCATGGAAGG - Intergenic
936985565 2:118309066-118309088 ATGTCTTTCCTAATCATGGATGG - Intergenic
939140332 2:138346555-138346577 CTTTGTGACCTTTTCATGGAAGG + Intergenic
940897567 2:159095336-159095358 CTGGGTTACCTATGCATGGACGG - Intronic
942997278 2:182277923-182277945 CAGTGTAACCTTGTCATGGTAGG - Intronic
944202447 2:197121970-197121992 CTGTGGAGTCTAAACATGGAAGG + Intronic
948671233 2:239570147-239570169 CGGTGTCACCTCCTCATGGAAGG + Intergenic
1173425025 20:42935102-42935124 TTTTGCAACCTAATCTTGGAAGG + Intronic
1173452908 20:43180954-43180976 CTTTGTAACCTAATTTGGGAAGG - Intronic
1174911958 20:54617266-54617288 CTATGTATCACAATCATGGAAGG + Intronic
1179563106 21:42229119-42229141 CAGCCTAACCTAATCATGGCTGG - Intronic
1181456197 22:23061462-23061484 CAGGGTAACAGAATCATGGATGG + Intronic
1184624316 22:45711455-45711477 CTCTGTAACTTAATAATGCAGGG - Intronic
949171533 3:1004770-1004792 CTGTGTAAGTAAATTATGGATGG + Intergenic
954990578 3:54837484-54837506 CAGTGCACCATAATCATGGATGG - Intronic
957923477 3:86778032-86778054 CTGTGTCATCTCATAATGGAAGG + Intergenic
961444051 3:126970444-126970466 ATGTGTAACATAATCATGAGAGG + Intergenic
967047201 3:185748468-185748490 CTATGTAACCTATTACTGGAGGG - Intronic
967327483 3:188256157-188256179 CTGTGAAAGCTAATAATGTATGG + Intronic
971361365 4:25941247-25941269 ATTAGTAACTTAATCATGGATGG - Intergenic
973641582 4:52908270-52908292 CCATATAACCTAAACATGGACGG - Intronic
977675650 4:99744027-99744049 TTTGGTTACCTAATCATGGAAGG - Intergenic
978015805 4:103744602-103744624 CGGTGTCATCTAATCTTGGAAGG + Intergenic
978711553 4:111788615-111788637 CTGTGACACCAAATCATTGAAGG - Intergenic
979099052 4:116591961-116591983 CTTTGAAATCTAATCAGGGAAGG + Intergenic
983805256 4:171985576-171985598 CTGTGTAACATAATAATCCATGG - Intronic
984137705 4:175961847-175961869 CTGTTTCACCTAAGCAGGGAAGG + Intronic
984460319 4:180028024-180028046 CTGTGTAACTTAATTTTGAATGG + Intergenic
987833559 5:23131078-23131100 CTGTGTAACCTTATAAAAGATGG + Intergenic
988862672 5:35300863-35300885 TTGTGTAACCAAAACATTGATGG + Intergenic
990597427 5:57325588-57325610 CTGTGTATCCTTATCTTGGGAGG + Intergenic
994153899 5:96480497-96480519 CAGTTTAGCCTATTCATGGAAGG - Intergenic
997238750 5:132292059-132292081 CTCTGTAACCAACTGATGGAGGG + Intronic
998778750 5:145632757-145632779 TAATGTAACATAATCATGGAGGG - Intronic
1004811718 6:19270264-19270286 CTGTGTATACTATTCTTGGATGG - Intergenic
1005404611 6:25473248-25473270 ATTAGTAACCTAATCATGGTAGG + Intronic
1007160610 6:39789119-39789141 CTGTGTGACCTCAGCATGGCAGG - Intergenic
1007749749 6:44064640-44064662 CTGTGCAGCCTCATCATGGTGGG - Intergenic
1009641314 6:66341012-66341034 CAGTGTAACCTAGTCATAGGTGG + Intergenic
1010286713 6:74086409-74086431 CTGTGTAACCTGTTTCTGGATGG - Intergenic
1015367248 6:132410136-132410158 CTGTGTATTCTAATCACTGACGG - Intergenic
1017373171 6:153736437-153736459 CTCTGTAGCCTATTCATGGAGGG + Intergenic
1017941768 6:159059724-159059746 CAGTGTGACCTCATCATGGAAGG - Intergenic
1021480567 7:21111160-21111182 CCGTGTCACCCAATCATTGATGG + Intergenic
1021993532 7:26158628-26158650 CTCTGTAACCTACTAATGGAGGG - Intronic
1023265496 7:38401196-38401218 ATGTGTAACCTAATAATTGTTGG - Intronic
1024933722 7:54690947-54690969 CTTTGGAAACTAAACATGGATGG + Intergenic
1026217073 7:68359017-68359039 CTCAGTAACCCAATCATGTAGGG - Intergenic
1027287866 7:76668398-76668420 ATGAGTAACCTAATAATGTAGGG - Intergenic
1027371746 7:77513236-77513258 CTAGGTAACCTAAATATGGAGGG + Intergenic
1027371774 7:77513515-77513537 CTAGGTAACCTAAATATGGAGGG + Intergenic
1027497954 7:78911566-78911588 CTGGGTAACTTAATTCTGGAGGG - Intronic
1028308897 7:89304157-89304179 CTTTGAAATATAATCATGGAAGG + Intronic
1029240862 7:99161155-99161177 CTTTATAACCTAATCTTAGAAGG - Intergenic
1032052883 7:128659998-128660020 TTTTATAACCTAATCTTGGAAGG + Intergenic
1035160532 7:156947242-156947264 CTGTGTCACTAAATGATGGACGG + Intergenic
1037673961 8:21038580-21038602 CAATGTAACCTGATCACGGAGGG + Intergenic
1043020267 8:74991430-74991452 CTTTATAAGCTAATCATGGTGGG - Intronic
1043412297 8:80010258-80010280 CTGTGAGAGCAAATCATGGAAGG + Intronic
1047182227 8:122600055-122600077 CTGTACAACCTAATCTGGGAAGG - Intergenic
1048234277 8:132675050-132675072 CAGTGTAGCCTAATGGTGGAGGG - Intronic
1048840517 8:138561951-138561973 ATGTGTAATGTGATCATGGAAGG + Intergenic
1051376018 9:16403831-16403853 TTTTATAACCCAATCATGGAAGG + Intergenic
1059538897 9:115111333-115111355 CTGTGTAACCTAATCATGGAAGG - Intronic
1060248926 9:121970424-121970446 CTGTGCCACCTAAACATGAAGGG - Intronic
1061297481 9:129684808-129684830 TTGTCTCACCTAATCACGGAGGG + Intronic
1185859402 X:3563592-3563614 GTGTGTAACCTAAACATTTAGGG - Intergenic
1188975155 X:36664005-36664027 CTGTGTTATCTAATCTTTGAAGG + Intergenic
1192174078 X:68875024-68875046 CTGTGGAATCTAATCACTGATGG - Intergenic
1197857625 X:130933661-130933683 CTGTGTAACACAATCATGAGAGG + Intergenic
1197980412 X:132212518-132212540 CTGTCTACACTAATGATGGAAGG + Intronic
1199913090 X:152308497-152308519 CTGTGTGCTCTAATCCTGGAGGG - Intronic